Incidental Mutation 'R0706:Xpo1'
ID 63138
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Name exportin 1
Synonyms Crm1
MMRRC Submission 038889-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0706 (G1)
Quality Score 169
Status Not validated
Chromosome 11
Chromosomal Location 23256041-23298249 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23280441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 276 (V276E)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
AlphaFold Q6P5F9
PDB Structure Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020538
AA Change: V276E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: V276E

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102869
AA Change: V276E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: V276E

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102870
AA Change: V276E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: V276E

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109551
AA Change: V276E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: V276E

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149371
Predicted Effect probably benign
Transcript: ENSMUST00000150750
SMART Domains Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

DomainStartEndE-ValueType
Blast:CRM1_C 97 136 3e-8 BLAST
Pfam:CRM1_C 171 233 4.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef15 C T 11: 68,954,576 R150H probably damaging Het
Btnl2 T A 17: 34,368,662 N493K probably benign Het
Ccdc175 G A 12: 72,139,948 T374I probably benign Het
Dock4 A G 12: 40,702,923 S419G probably damaging Het
Ireb2 A G 9: 54,892,486 T404A probably benign Het
Klk1b5 C T 7: 44,218,514 P37S probably damaging Het
Lrrc32 C T 7: 98,499,710 R566W probably damaging Het
Med12l A G 3: 59,261,980 N1597S probably damaging Het
Mrpl50 T C 4: 49,514,198 S158G probably benign Het
Mycbpap G T 11: 94,513,786 Y110* probably null Het
Nphp4 G A 4: 152,555,617 A987T probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tprn A G 2: 25,264,491 I602V probably damaging Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
R8823:Xpo1 UTSW 11 23267752 missense probably benign
R9128:Xpo1 UTSW 11 23285058 missense probably damaging 1.00
R9232:Xpo1 UTSW 11 23282646 missense probably benign
R9277:Xpo1 UTSW 11 23291550 missense probably benign 0.17
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGACATCTGTGATGCAGAGCAAA -3'
(R):5'- catctctccagccccCCTATAGTTT -3'

Sequencing Primer
(F):5'- aagagggtgttgaatctcctg -3'
(R):5'- agccccCCTATAGTTTAATTTAAACC -3'
Posted On 2013-07-30