Incidental Mutation 'R8119:Cldn23'
ID631397
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8119 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35825902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000049725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect probably damaging
Transcript: ENSMUST00000060128
AA Change: V144A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976
AA Change: V144A

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210370
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik G A 8: 36,498,422 W32* probably null Het
Abca6 T C 11: 110,197,104 I1066V probably benign Het
Abcd2 T C 15: 91,148,994 T740A probably benign Het
Amigo1 T C 3: 108,187,536 L117P probably damaging Het
Ankar A T 1: 72,647,001 S1347T probably damaging Het
Apol7e T C 15: 77,717,756 S185P probably damaging Het
Ash1l G A 3: 89,035,427 C2088Y probably damaging Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Caln1 A G 5: 130,822,984 S205G probably damaging Het
Cfap54 T C 10: 92,868,810 I2803V unknown Het
Cfh A C 1: 140,120,015 F477V possibly damaging Het
Csmd1 A G 8: 17,027,294 S116P probably damaging Het
Dgkd A T 1: 87,917,967 T299S possibly damaging Het
Fam20b T G 1: 156,690,502 T241P probably damaging Het
Fndc3b A T 3: 27,451,344 M925K probably benign Het
Gm813 C A 16: 58,616,848 M32I probably benign Het
Ints3 C T 3: 90,392,300 R987Q probably damaging Het
Kctd10 A G 5: 114,367,255 V226A probably damaging Het
Lypd2 A G 15: 74,733,032 V38A probably benign Het
Map3k1 T C 13: 111,772,622 R265G possibly damaging Het
Mcc C T 18: 44,468,433 V610M possibly damaging Het
Mocs1 C T 17: 49,449,519 R244C probably damaging Het
Nav2 A G 7: 49,453,484 T677A probably damaging Het
Ngp A G 9: 110,422,353 N150D probably benign Het
Nipbl C T 15: 8,359,212 R308Q probably benign Het
Nsrp1 A G 11: 77,048,351 probably null Het
Olfr1317 T A 2: 112,142,563 I206N probably damaging Het
Olfr1388 A T 11: 49,444,126 I92F probably damaging Het
Olfr659 A T 7: 104,670,854 I51F probably damaging Het
Pbld2 A T 10: 63,053,877 D146V probably benign Het
Prss22 T A 17: 23,994,727 K197* probably null Het
Ptprd G T 4: 76,129,026 S87R probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc25a35 T C 11: 68,971,972 L251S probably benign Het
Slx4 A T 16: 3,985,272 L1226* probably null Het
Smarca4 T C 9: 21,647,626 V651A possibly damaging Het
Smarcad1 T C 6: 65,094,319 F583L probably benign Het
Taf2 T C 15: 55,031,130 K932E probably benign Het
Trav8d-1 A T 14: 52,778,968 T104S probably benign Het
Trpm4 A T 7: 45,327,128 V155D probably damaging Het
Ttc6 A T 12: 57,705,643 Y1445F possibly damaging Het
Ttll5 C A 12: 86,020,548 N1270K probably damaging Het
Usp40 G T 1: 87,967,678 probably null Het
Vmn2r74 T C 7: 85,961,482 M1V probably null Het
Wwox T C 8: 114,706,368 V258A probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp770 G A 2: 114,197,027 T187I probably damaging Het
Zranb2 A G 3: 157,536,332 probably null Het
Zscan4-ps3 A G 7: 11,610,340 Q75R probably damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R4342:Cldn23 UTSW 8 35825498 missense probably benign 0.00
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R5207:Cldn23 UTSW 8 35826028 missense probably damaging 1.00
R6102:Cldn23 UTSW 8 35825551 missense probably benign 0.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7363:Cldn23 UTSW 8 35825505 critical splice donor site probably null
R7721:Cldn23 UTSW 8 35826263 missense possibly damaging 0.89
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGATGGCAGGTGTGAGC -3'
(R):5'- CTCATGATCACGTCACTGGC -3'

Sequencing Primer
(F):5'- TCCACGTAGACGGTGCTGATG -3'
(R):5'- TGATCACGTCACTGGCCACTAC -3'
Posted On2020-06-30