Incidental Mutation 'R0706:Mycbpap'
ID63141
Institutional Source Beutler Lab
Gene Symbol Mycbpap
Ensembl Gene ENSMUSG00000039110
Gene NameMYCBP associated protein
SynonymsAMAP-1, 4932408B01Rik
MMRRC Submission 038889-MU
Accession Numbers

NCBI RefSeq: NM_170671.2; MGI: 2388726

Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R0706 (G1)
Quality Score113
Status Not validated
Chromosome11
Chromosomal Location94501347-94521742 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 94513786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 110 (Y110*)
Ref Sequence ENSEMBL: ENSMUSP00000091477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093945]
Predicted Effect probably null
Transcript: ENSMUST00000093945
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000091477
Gene: ENSMUSG00000039110
AA Change: Y110*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:MYCBPAP 184 602 3.7e-144 PFAM
low complexity region 848 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151993
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef15 C T 11: 68,954,576 R150H probably damaging Het
Btnl2 T A 17: 34,368,662 N493K probably benign Het
Ccdc175 G A 12: 72,139,948 T374I probably benign Het
Dock4 A G 12: 40,702,923 S419G probably damaging Het
Ireb2 A G 9: 54,892,486 T404A probably benign Het
Klk1b5 C T 7: 44,218,514 P37S probably damaging Het
Lrrc32 C T 7: 98,499,710 R566W probably damaging Het
Med12l A G 3: 59,261,980 N1597S probably damaging Het
Mrpl50 T C 4: 49,514,198 S158G probably benign Het
Nphp4 G A 4: 152,555,617 A987T probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tprn A G 2: 25,264,491 I602V probably damaging Het
Xpo1 T A 11: 23,280,441 V276E probably benign Het
Other mutations in Mycbpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Mycbpap APN 11 94509319 unclassified probably null
IGL01372:Mycbpap APN 11 94506456 missense possibly damaging 0.56
IGL01627:Mycbpap APN 11 94514604 missense probably damaging 0.98
IGL01645:Mycbpap APN 11 94503467 splice site probably null
IGL01712:Mycbpap APN 11 94512655 missense possibly damaging 0.50
IGL02209:Mycbpap APN 11 94509882 splice site probably benign
IGL02377:Mycbpap APN 11 94503250 missense probably damaging 1.00
IGL03088:Mycbpap APN 11 94513943 critical splice acceptor site probably null
IGL03412:Mycbpap APN 11 94508101 splice site probably null
IGL03046:Mycbpap UTSW 11 94505717 missense possibly damaging 0.84
P0008:Mycbpap UTSW 11 94504067 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0437:Mycbpap UTSW 11 94513512 splice site probably benign
R0791:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1496:Mycbpap UTSW 11 94505561 missense probably benign 0.11
R1522:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1698:Mycbpap UTSW 11 94508143 nonsense probably null
R1796:Mycbpap UTSW 11 94507551 missense probably damaging 1.00
R1906:Mycbpap UTSW 11 94505621 missense probably benign 0.24
R4115:Mycbpap UTSW 11 94512225 splice site probably null
R4930:Mycbpap UTSW 11 94503157 missense probably benign 0.20
R4965:Mycbpap UTSW 11 94504938 missense probably damaging 1.00
R5323:Mycbpap UTSW 11 94503504 missense probably benign 0.00
R5326:Mycbpap UTSW 11 94507746 splice site probably null
R5542:Mycbpap UTSW 11 94507746 splice site probably null
R5625:Mycbpap UTSW 11 94505693 missense probably damaging 0.99
R5841:Mycbpap UTSW 11 94505610 missense probably damaging 1.00
R5996:Mycbpap UTSW 11 94513594 missense probably benign
R6065:Mycbpap UTSW 11 94508187 unclassified probably null
R6192:Mycbpap UTSW 11 94507731 missense probably damaging 1.00
R7027:Mycbpap UTSW 11 94514614 missense probably damaging 1.00
R7329:Mycbpap UTSW 11 94509247 missense probably damaging 1.00
R7513:Mycbpap UTSW 11 94503556 missense probably damaging 1.00
Z1177:Mycbpap UTSW 11 94509854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTTCTCTCAGCCACATAGCTC -3'
(R):5'- GTCACACAGGCATTTCCAGGACAG -3'

Sequencing Primer
(F):5'- GAGACTTCCCAAGATCTGGTG -3'
(R):5'- GCATTTCCAGGACAGGATGTATG -3'
Posted On2013-07-30