Incidental Mutation 'R8119:Nipbl'
ID 631413
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R8119 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8359212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 308 (R308Q)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: R308Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: R308Q

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik G A 8: 36,498,422 W32* probably null Het
Abca6 T C 11: 110,197,104 I1066V probably benign Het
Abcd2 T C 15: 91,148,994 T740A probably benign Het
Amigo1 T C 3: 108,187,536 L117P probably damaging Het
Ankar A T 1: 72,647,001 S1347T probably damaging Het
Apol7e T C 15: 77,717,756 S185P probably damaging Het
Ash1l G A 3: 89,035,427 C2088Y probably damaging Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Caln1 A G 5: 130,822,984 S205G probably damaging Het
Cfap54 T C 10: 92,868,810 I2803V unknown Het
Cfh A C 1: 140,120,015 F477V possibly damaging Het
Cldn23 A G 8: 35,825,902 V144A probably damaging Het
Csmd1 A G 8: 17,027,294 S116P probably damaging Het
Dgkd A T 1: 87,917,967 T299S possibly damaging Het
Fam20b T G 1: 156,690,502 T241P probably damaging Het
Fndc3b A T 3: 27,451,344 M925K probably benign Het
Gm813 C A 16: 58,616,848 M32I probably benign Het
Ints3 C T 3: 90,392,300 R987Q probably damaging Het
Kctd10 A G 5: 114,367,255 V226A probably damaging Het
Lypd2 A G 15: 74,733,032 V38A probably benign Het
Map3k1 T C 13: 111,772,622 R265G possibly damaging Het
Mcc C T 18: 44,468,433 V610M possibly damaging Het
Mocs1 C T 17: 49,449,519 R244C probably damaging Het
Nav2 A G 7: 49,453,484 T677A probably damaging Het
Ngp A G 9: 110,422,353 N150D probably benign Het
Nsrp1 A G 11: 77,048,351 probably null Het
Olfr1317 T A 2: 112,142,563 I206N probably damaging Het
Olfr1388 A T 11: 49,444,126 I92F probably damaging Het
Olfr659 A T 7: 104,670,854 I51F probably damaging Het
Pbld2 A T 10: 63,053,877 D146V probably benign Het
Prss22 T A 17: 23,994,727 K197* probably null Het
Ptprd G T 4: 76,129,026 S87R probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc25a35 T C 11: 68,971,972 L251S probably benign Het
Slx4 A T 16: 3,985,272 L1226* probably null Het
Smarca4 T C 9: 21,647,626 V651A possibly damaging Het
Smarcad1 T C 6: 65,094,319 F583L probably benign Het
Taf2 T C 15: 55,031,130 K932E probably benign Het
Trav8d-1 A T 14: 52,778,968 T104S probably benign Het
Trpm4 A T 7: 45,327,128 V155D probably damaging Het
Ttc6 A T 12: 57,705,643 Y1445F possibly damaging Het
Ttll5 C A 12: 86,020,548 N1270K probably damaging Het
Usp40 G T 1: 87,967,678 probably null Het
Vmn2r74 T C 7: 85,961,482 M1V probably null Het
Wwox T C 8: 114,706,368 V258A probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp770 G A 2: 114,197,027 T187I probably damaging Het
Zranb2 A G 3: 157,536,332 probably null Het
Zscan4-ps3 A G 7: 11,610,340 Q75R probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R3620_nipbl_616 UTSW 15 8333024 missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
R8854:Nipbl UTSW 15 8300726 missense probably damaging 1.00
R8887:Nipbl UTSW 15 8361787 missense probably damaging 1.00
R8942:Nipbl UTSW 15 8351620 missense probably benign
R8991:Nipbl UTSW 15 8291513 missense probably damaging 1.00
R9008:Nipbl UTSW 15 8327124 missense probably damaging 1.00
R9070:Nipbl UTSW 15 8338731 missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8350856 missense probably benign 0.00
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCAGATAGCATATCGTCTTGC -3'
(R):5'- TGTAGTTCAAGCTACAGTTCCAAAG -3'

Sequencing Primer
(F):5'- TGCTGGTCCATATCTGAAGATC -3'
(R):5'- GCTACAGTTCCAAAGTACCTTGG -3'
Posted On 2020-06-30