Incidental Mutation 'R0706:Tcam1'
ID63142
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Nametesticular cell adhesion molecule 1
Synonyms
MMRRC Submission 038889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0706 (G1)
Quality Score129
Status Not validated
Chromosome11
Chromosomal Location106276672-106288745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106284078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 120 (E120K)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: E120K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
AA Change: E120K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef15 C T 11: 68,954,576 R150H probably damaging Het
Btnl2 T A 17: 34,368,662 N493K probably benign Het
Ccdc175 G A 12: 72,139,948 T374I probably benign Het
Dock4 A G 12: 40,702,923 S419G probably damaging Het
Ireb2 A G 9: 54,892,486 T404A probably benign Het
Klk1b5 C T 7: 44,218,514 P37S probably damaging Het
Lrrc32 C T 7: 98,499,710 R566W probably damaging Het
Med12l A G 3: 59,261,980 N1597S probably damaging Het
Mrpl50 T C 4: 49,514,198 S158G probably benign Het
Mycbpap G T 11: 94,513,786 Y110* probably null Het
Nphp4 G A 4: 152,555,617 A987T probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tprn A G 2: 25,264,491 I602V probably damaging Het
Xpo1 T A 11: 23,280,441 V276E probably benign Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106285386 missense probably benign
IGL03396:Tcam1 APN 11 106285386 missense probably benign
IGL03397:Tcam1 APN 11 106285386 missense probably benign
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0306:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0313:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0378:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0380:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0381:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0382:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0393:Tcam1 UTSW 11 106284214 missense probably benign 0.19
R0401:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0448:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0537:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0602:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0669:Tcam1 UTSW 11 106285426 missense possibly damaging 0.94
R2307:Tcam1 UTSW 11 106284114 missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106282879 missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106285452 missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106285527 missense probably benign 0.24
R5437:Tcam1 UTSW 11 106285423 missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106284054 nonsense probably null
R6248:Tcam1 UTSW 11 106282826 missense probably benign 0.17
R6302:Tcam1 UTSW 11 106286450 missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106284085 missense probably damaging 1.00
R8236:Tcam1 UTSW 11 106286417 missense probably benign 0.01
R8402:Tcam1 UTSW 11 106286905 missense probably damaging 0.99
Z1177:Tcam1 UTSW 11 106282847 frame shift probably null
Z1177:Tcam1 UTSW 11 106282850 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCAAGCTTCTTATGCCTCTGAGACC -3'
(R):5'- AGAAATTACGCCTGTCATTGTCCCG -3'

Sequencing Primer
(F):5'- GCCTCTGAGACCTCTCTGATAAG -3'
(R):5'- CGGTGGGCTCTGACAGTG -3'
Posted On2013-07-30