Mutagenetix > Incidental Mutation

Incidental Mutation 'R8120:Cubn'

631429

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin

Synonyms

D2Wsu88e, intrinsic factor-cobalamin receptor

MMRRC Submission

067549-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8120 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13281149-13496624 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 13336471 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2452 (C2452S)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: C2452S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: C2452S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 95.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	T	4: 144,349,460 (GRCm39)	Q239L	probably benign	Het
Abca12	T	C	1: 71,298,540 (GRCm39)	I2361V	possibly damaging	Het
Abcc8	T	C	7: 45,786,108 (GRCm39)	E655G	probably benign	Het
Ablim1	C	T	19: 57,035,360 (GRCm39)	V662I	probably benign	Het
Acte1	A	G	7: 143,425,524 (GRCm39)	T58A	probably benign	Het
Als2cl	A	C	9: 110,714,460 (GRCm39)	I103L	possibly damaging	Het
Arhgef26	A	T	3: 62,248,796 (GRCm39)	D370V	probably damaging	Het
Brwd1	A	C	16: 95,820,649 (GRCm39)	D1292E	probably benign	Het
Cdc5l	T	C	17: 45,718,796 (GRCm39)	T607A	probably benign	Het
Cfhr1	T	C	1: 139,475,583 (GRCm39)	Y296C	unknown	Het
Dgcr2	A	T	16: 17,675,183 (GRCm39)	Y187*	probably null	Het
Dhodh	G	A	8: 110,328,057 (GRCm39)	T172I	probably benign	Het
Dnah6	G	A	6: 73,002,769 (GRCm39)	R3876C	probably damaging	Het
Dnai4	G	A	4: 102,923,531 (GRCm39)	R433W	probably damaging	Het
Farsb	A	T	1: 78,439,475 (GRCm39)	N389K	probably benign	Het
Fryl	T	C	5: 73,228,527 (GRCm39)	T1735A	probably benign	Het
Garin4	T	G	1: 190,895,022 (GRCm39)	Q540H	probably damaging	Het
Gpcpd1	C	T	2: 132,395,943 (GRCm39)	R136H	probably damaging	Het
Gpr171	T	A	3: 59,005,406 (GRCm39)	Y123F	probably damaging	Het
Hcar1	C	A	5: 124,017,068 (GRCm39)	V208F	probably damaging	Het
Hgf	T	A	5: 16,818,779 (GRCm39)	L524M	probably damaging	Het
Itga2b	A	T	11: 102,360,368 (GRCm39)	H57Q	probably damaging	Het
Itpripl2	G	T	7: 118,089,508 (GRCm39)	N350K	probably damaging	Het
Limk2	C	T	11: 3,298,589 (GRCm39)		probably null	Het
Nae1	A	T	8: 105,246,267 (GRCm39)	V315E	probably damaging	Het
Nars1	T	C	18: 64,637,422 (GRCm39)	Y386C	probably benign	Het
Odr4	T	C	1: 150,260,177 (GRCm39)		probably null	Het
Or10j3	C	T	1: 173,031,502 (GRCm39)	T193I	probably benign	Het
Or6z5	A	T	7: 6,477,119 (GRCm39)	R3S	probably benign	Het
Pcnx3	C	T	19: 5,717,574 (GRCm39)	A1512T	probably benign	Het
Pde1b	A	G	15: 103,430,524 (GRCm39)	D176G	possibly damaging	Het
Pde4dip	T	A	3: 97,614,254 (GRCm39)	T1855S	probably null	Het
Prr12	A	G	7: 44,684,166 (GRCm39)	Y1625H	probably damaging	Het
Psmc2	T	C	5: 22,005,566 (GRCm39)	Y216H	probably damaging	Het
Ptchd3	A	T	11: 121,733,034 (GRCm39)	E641D	probably benign	Het
Rtf1	A	G	2: 119,531,602 (GRCm39)	T110A	probably damaging	Het
Rusc1	C	A	3: 88,996,513 (GRCm39)	W690L	probably damaging	Het
Sardh	A	G	2: 27,108,863 (GRCm39)	V624A	possibly damaging	Het
Slc17a9	G	A	2: 180,374,308 (GRCm39)	G125S	probably benign	Het
Smpdl3a	A	T	10: 57,683,547 (GRCm39)	N219I	probably damaging	Het
Spo11	G	T	2: 172,827,251 (GRCm39)	D155Y	probably damaging	Het
Stk38l	A	G	6: 146,660,099 (GRCm39)	T44A	probably benign	Het
Tceanc2	A	T	4: 107,034,829 (GRCm39)	I11N	probably benign	Het
Tead2	A	T	7: 44,865,752 (GRCm39)		probably benign	Het
Tpk1	A	G	6: 43,445,930 (GRCm39)		probably null	Het
Ttn	T	C	2: 76,593,835 (GRCm39)	N20602D	probably damaging	Het
Tub	T	A	7: 108,624,803 (GRCm39)		probably null	Het
Uba2	A	T	7: 33,867,812 (GRCm39)	S42T	probably benign	Het
Vangl1	T	A	3: 102,070,758 (GRCm39)	R393*	probably null	Het
Washc3	G	A	10: 88,037,159 (GRCm39)		probably null	Het
Wipf1	G	A	2: 73,267,879 (GRCm39)	P173L	possibly damaging	Het
Zfp217	G	A	2: 169,961,571 (GRCm39)	S252F	possibly damaging	Het
Zfp267	A	T	3: 36,218,640 (GRCm39)	N221I	possibly damaging	Het
Zfp386	C	T	12: 116,018,573 (GRCm39)	P81S	unknown	Het
Zw10	A	T	9: 48,985,413 (GRCm39)	E616D	probably benign	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,496,631 (GRCm39)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,461,508 (GRCm39)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,386,660 (GRCm39)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,431,867 (GRCm39)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,283,229 (GRCm39)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,287,730 (GRCm39)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,299,041 (GRCm39)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,472,521 (GRCm39)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,386,738 (GRCm39)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,461,434 (GRCm39)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,283,219 (GRCm39)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,482,904 (GRCm39)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,315,377 (GRCm39)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,470,719 (GRCm39)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,288,852 (GRCm39)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,355,673 (GRCm39)	splice site	probably benign
IGL01534:Cubn	APN	2	13,470,744 (GRCm39)	nonsense	probably null
IGL01584:Cubn	APN	2	13,313,472 (GRCm39)	splice site	probably benign
IGL01595:Cubn	APN	2	13,330,027 (GRCm39)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,311,085 (GRCm39)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,494,747 (GRCm39)	nonsense	probably null
IGL01972:Cubn	APN	2	13,450,883 (GRCm39)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,292,405 (GRCm39)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,344,657 (GRCm39)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,386,648 (GRCm39)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,432,645 (GRCm39)	splice site	probably null
IGL02491:Cubn	APN	2	13,326,039 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,330,037 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,450,843 (GRCm39)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,449,851 (GRCm39)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,299,181 (GRCm39)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,323,123 (GRCm39)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,291,905 (GRCm39)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,360,500 (GRCm39)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,431,778 (GRCm39)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,365,140 (GRCm39)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,482,868 (GRCm39)	splice site	probably null
mellow	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,473,663 (GRCm39)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,496,561 (GRCm39)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,311,243 (GRCm39)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,361,520 (GRCm39)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,480,846 (GRCm39)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,445,325 (GRCm39)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,429,505 (GRCm39)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0364:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0383:Cubn	UTSW	2	13,435,770 (GRCm39)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,474,575 (GRCm39)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,474,574 (GRCm39)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,449,078 (GRCm39)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,433,491 (GRCm39)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,365,063 (GRCm39)	splice site	probably null
R0735:Cubn	UTSW	2	13,496,500 (GRCm39)	splice site	probably benign
R0780:Cubn	UTSW	2	13,461,424 (GRCm39)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,367,139 (GRCm39)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,341,053 (GRCm39)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,449,811 (GRCm39)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,365,130 (GRCm39)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,480,931 (GRCm39)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,431,916 (GRCm39)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,292,472 (GRCm39)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,432,778 (GRCm39)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,474,600 (GRCm39)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,494,128 (GRCm39)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,313,372 (GRCm39)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,327,813 (GRCm39)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,315,337 (GRCm39)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,283,349 (GRCm39)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,344,828 (GRCm39)	splice site	probably null
R2021:Cubn	UTSW	2	13,313,360 (GRCm39)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,449,189 (GRCm39)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,323,053 (GRCm39)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,408,891 (GRCm39)	nonsense	probably null
R2369:Cubn	UTSW	2	13,496,028 (GRCm39)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,480,961 (GRCm39)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,323,083 (GRCm39)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,283,167 (GRCm39)	splice site	probably null
R2850:Cubn	UTSW	2	13,327,764 (GRCm39)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,435,645 (GRCm39)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,362,950 (GRCm39)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,362,973 (GRCm39)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,338,319 (GRCm39)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,336,396 (GRCm39)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,432,725 (GRCm39)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,365,164 (GRCm39)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,299,136 (GRCm39)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,291,791 (GRCm39)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,331,488 (GRCm39)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,318,810 (GRCm39)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,433,374 (GRCm39)	intron	probably benign
R4405:Cubn	UTSW	2	13,470,841 (GRCm39)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,433,560 (GRCm39)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,318,790 (GRCm39)	splice site	probably null
R4770:Cubn	UTSW	2	13,319,578 (GRCm39)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,355,869 (GRCm39)	missense	probably damaging	1.00
R4799:Cubn	UTSW	2	13,291,835 (GRCm39)	missense	possibly damaging	0.94
R4812:Cubn	UTSW	2	13,463,887 (GRCm39)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,330,036 (GRCm39)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,494,721 (GRCm39)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,352,856 (GRCm39)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,483,013 (GRCm39)	nonsense	probably null
R5305:Cubn	UTSW	2	13,393,750 (GRCm39)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,496,506 (GRCm39)	splice site	probably null
R5530:Cubn	UTSW	2	13,313,334 (GRCm39)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,355,743 (GRCm39)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,393,702 (GRCm39)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,324,834 (GRCm39)	splice site	probably benign
R5923:Cubn	UTSW	2	13,490,889 (GRCm39)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,435,708 (GRCm39)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,313,429 (GRCm39)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,354,687 (GRCm39)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,285,006 (GRCm39)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,480,934 (GRCm39)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,435,806 (GRCm39)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,432,646 (GRCm39)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,360,491 (GRCm39)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,299,014 (GRCm39)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,463,813 (GRCm39)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,315,484 (GRCm39)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,435,683 (GRCm39)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,480,875 (GRCm39)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,326,066 (GRCm39)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,449,840 (GRCm39)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,449,064 (GRCm39)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,323,089 (GRCm39)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,352,840 (GRCm39)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,386,648 (GRCm39)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,491,600 (GRCm39)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,311,092 (GRCm39)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,311,091 (GRCm39)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,324,669 (GRCm39)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,347,309 (GRCm39)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,355,814 (GRCm39)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,429,550 (GRCm39)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,345,143 (GRCm39)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,473,582 (GRCm39)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,291,875 (GRCm39)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,431,778 (GRCm39)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,460,320 (GRCm39)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7700:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7751:Cubn	UTSW	2	13,365,176 (GRCm39)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,284,889 (GRCm39)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,352,961 (GRCm39)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,473,680 (GRCm39)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,429,538 (GRCm39)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,337,166 (GRCm39)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,340,897 (GRCm39)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,483,989 (GRCm39)	missense	probably benign	0.01
R8133:Cubn	UTSW	2	13,393,659 (GRCm39)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,299,129 (GRCm39)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,354,688 (GRCm39)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,491,613 (GRCm39)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,311,274 (GRCm39)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,345,053 (GRCm39)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,435,658 (GRCm39)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,433,535 (GRCm39)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,329,971 (GRCm39)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,433,567 (GRCm39)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,386,610 (GRCm39)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,318,855 (GRCm39)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,313,331 (GRCm39)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,388,770 (GRCm39)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,313,377 (GRCm39)	nonsense	probably null
R8874:Cubn	UTSW	2	13,365,157 (GRCm39)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,461,466 (GRCm39)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,291,914 (GRCm39)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,337,276 (GRCm39)	splice site	probably benign
R9261:Cubn	UTSW	2	13,283,262 (GRCm39)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,386,703 (GRCm39)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,463,767 (GRCm39)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,292,510 (GRCm39)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,482,945 (GRCm39)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,325,991 (GRCm39)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,319,529 (GRCm39)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,433,530 (GRCm39)	missense	probably benign
X0018:Cubn	UTSW	2	13,463,797 (GRCm39)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,480,887 (GRCm39)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,347,392 (GRCm39)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,327,773 (GRCm39)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,388,803 (GRCm39)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,299,040 (GRCm39)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,386,636 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAATGAGGTGCTCAGTGTTG -3'
(R):5'- CCAGTGAACTGTTTTCTATGGAAG -3'

Sequencing Primer
(F):5'- GCAGGATTGCTGGGTACTTAGC -3'
(R):5'- GAGCACTCTCATACATGTG -3'

Posted On

2020-06-30