Mutagenetix > Incidental Mutation

Incidental Mutation 'R8120:Sardh'

631430

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R8120 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27218851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 624 (V624A)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102886
AA Change: V624A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: V624A

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 95.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	T	4: 144,622,890	Q239L	probably benign	Het
Abca12	T	C	1: 71,259,381	I2361V	possibly damaging	Het
Abcc8	T	C	7: 46,136,684	E655G	probably benign	Het
Ablim1	C	T	19: 57,046,928	V662I	probably benign	Het
Als2cl	A	C	9: 110,885,392	I103L	possibly damaging	Het
Arhgef26	A	T	3: 62,341,375	D370V	probably damaging	Het
BC003331	T	C	1: 150,384,426		probably null	Het
Brwd1	A	C	16: 96,019,449	D1292E	probably benign	Het
Cdc5l	T	C	17: 45,407,870	T607A	probably benign	Het
Cfhr1	T	C	1: 139,547,845	Y296C	unknown	Het
Cubn	A	T	2: 13,331,660	C2452S	probably damaging	Het
D3Ertd254e	A	T	3: 36,164,491	N221I	possibly damaging	Het
Dgcr2	A	T	16: 17,857,319	Y187*	probably null	Het
Dhodh	G	A	8: 109,601,425	T172I	probably benign	Het
Dnah6	G	A	6: 73,025,786	R3876C	probably damaging	Het
Fam71a	T	G	1: 191,162,825	Q540H	probably damaging	Het
Farsb	A	T	1: 78,462,838	N389K	probably benign	Het
Fryl	T	C	5: 73,071,184	T1735A	probably benign	Het
Gm498	A	G	7: 143,871,787	T58A	probably benign	Het
Gpcpd1	C	T	2: 132,554,023	R136H	probably damaging	Het
Gpr171	T	A	3: 59,097,985	Y123F	probably damaging	Het
Hcar1	C	A	5: 123,879,005	V208F	probably damaging	Het
Hgf	T	A	5: 16,613,781	L524M	probably damaging	Het
Itga2b	A	T	11: 102,469,542	H57Q	probably damaging	Het
Itpripl2	G	T	7: 118,490,285	N350K	probably damaging	Het
Limk2	C	T	11: 3,348,589		probably null	Het
Nae1	A	T	8: 104,519,635	V315E	probably damaging	Het
Nars	T	C	18: 64,504,351	Y386C	probably benign	Het
Olfr1346	A	T	7: 6,474,120	R3S	probably benign	Het
Olfr218	C	T	1: 173,203,935	T193I	probably benign	Het
Pcnx3	C	T	19: 5,667,546	A1512T	probably benign	Het
Pde1b	A	G	15: 103,522,097	D176G	possibly damaging	Het
Pde4dip	T	A	3: 97,706,938	T1855S	probably null	Het
Prr12	A	G	7: 45,034,742	Y1625H	probably damaging	Het
Psmc2	T	C	5: 21,800,568	Y216H	probably damaging	Het
Ptchd3	A	T	11: 121,842,208	E641D	probably benign	Het
Rtf1	A	G	2: 119,701,121	T110A	probably damaging	Het
Rusc1	C	A	3: 89,089,206	W690L	probably damaging	Het
Slc17a9	G	A	2: 180,732,515	G125S	probably benign	Het
Smpdl3a	A	T	10: 57,807,451	N219I	probably damaging	Het
Spo11	G	T	2: 172,985,458	D155Y	probably damaging	Het
Stk38l	A	G	6: 146,758,601	T44A	probably benign	Het
Tceanc2	A	T	4: 107,177,632	I11N	probably benign	Het
Tead2	A	T	7: 45,216,328		probably benign	Het
Tpk1	A	G	6: 43,468,996		probably null	Het
Ttn	T	C	2: 76,763,491	N20602D	probably damaging	Het
Tub	T	A	7: 109,025,596		probably null	Het
Uba2	A	T	7: 34,168,387	S42T	probably benign	Het
Vangl1	T	A	3: 102,163,442	R393*	probably null	Het
Washc3	G	A	10: 88,201,297		probably null	Het
Wdr78	G	A	4: 103,066,334	R433W	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp386	C	T	12: 116,054,953	P81S	unknown	Het
Zw10	A	T	9: 49,074,113	E616D	probably benign	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCATGGCAGGTAATTACATAG -3'
(R):5'- CCCAGATGACAACCATGGATG -3'

Sequencing Primer
(F):5'- GGCAGGTAATTACATAGTCATCCTGG -3'
(R):5'- ACCTCATCAGTAATCTGGTTGG -3'

Posted On

2020-06-30