Incidental Mutation 'R8120:Zw10'
ID631462
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8120 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49074113 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 616 (E616D)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably benign
Transcript: ENSMUST00000034803
AA Change: E616D

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: E616D

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,622,890 Q239L probably benign Het
Abca12 T C 1: 71,259,381 I2361V possibly damaging Het
Abcc8 T C 7: 46,136,684 E655G probably benign Het
Ablim1 C T 19: 57,046,928 V662I probably benign Het
Als2cl A C 9: 110,885,392 I103L possibly damaging Het
Arhgef26 A T 3: 62,341,375 D370V probably damaging Het
BC003331 T C 1: 150,384,426 probably null Het
Brwd1 A C 16: 96,019,449 D1292E probably benign Het
Cdc5l T C 17: 45,407,870 T607A probably benign Het
Cfhr1 T C 1: 139,547,845 Y296C unknown Het
Cubn A T 2: 13,331,660 C2452S probably damaging Het
D3Ertd254e A T 3: 36,164,491 N221I possibly damaging Het
Dgcr2 A T 16: 17,857,319 Y187* probably null Het
Dhodh G A 8: 109,601,425 T172I probably benign Het
Dnah6 G A 6: 73,025,786 R3876C probably damaging Het
Fam71a T G 1: 191,162,825 Q540H probably damaging Het
Farsb A T 1: 78,462,838 N389K probably benign Het
Fryl T C 5: 73,071,184 T1735A probably benign Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gpcpd1 C T 2: 132,554,023 R136H probably damaging Het
Gpr171 T A 3: 59,097,985 Y123F probably damaging Het
Hcar1 C A 5: 123,879,005 V208F probably damaging Het
Hgf T A 5: 16,613,781 L524M probably damaging Het
Itga2b A T 11: 102,469,542 H57Q probably damaging Het
Itpripl2 G T 7: 118,490,285 N350K probably damaging Het
Limk2 C T 11: 3,348,589 probably null Het
Nae1 A T 8: 104,519,635 V315E probably damaging Het
Nars T C 18: 64,504,351 Y386C probably benign Het
Olfr1346 A T 7: 6,474,120 R3S probably benign Het
Olfr218 C T 1: 173,203,935 T193I probably benign Het
Pcnx3 C T 19: 5,667,546 A1512T probably benign Het
Pde1b A G 15: 103,522,097 D176G possibly damaging Het
Pde4dip T A 3: 97,706,938 T1855S probably null Het
Prr12 A G 7: 45,034,742 Y1625H probably damaging Het
Psmc2 T C 5: 21,800,568 Y216H probably damaging Het
Ptchd3 A T 11: 121,842,208 E641D probably benign Het
Rtf1 A G 2: 119,701,121 T110A probably damaging Het
Rusc1 C A 3: 89,089,206 W690L probably damaging Het
Sardh A G 2: 27,218,851 V624A possibly damaging Het
Slc17a9 G A 2: 180,732,515 G125S probably benign Het
Smpdl3a A T 10: 57,807,451 N219I probably damaging Het
Spo11 G T 2: 172,985,458 D155Y probably damaging Het
Stk38l A G 6: 146,758,601 T44A probably benign Het
Tceanc2 A T 4: 107,177,632 I11N probably benign Het
Tead2 A T 7: 45,216,328 probably benign Het
Tpk1 A G 6: 43,468,996 probably null Het
Ttn T C 2: 76,763,491 N20602D probably damaging Het
Tub T A 7: 109,025,596 probably null Het
Uba2 A T 7: 34,168,387 S42T probably benign Het
Vangl1 T A 3: 102,163,442 R393* probably null Het
Washc3 G A 10: 88,201,297 probably null Het
Wdr78 G A 4: 103,066,334 R433W probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp386 C T 12: 116,054,953 P81S unknown Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 splice site probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 splice site probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
R7938:Zw10 UTSW 9 49071633 missense probably benign 0.04
R8376:Zw10 UTSW 9 49077483 missense possibly damaging 0.85
RF007:Zw10 UTSW 9 49060920 missense possibly damaging 0.81
Z1177:Zw10 UTSW 9 49074096 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGATCCAGAGTCGTTATACAC -3'
(R):5'- GACGGCTTCCACTTGTCTTG -3'

Sequencing Primer
(F):5'- ACAGGTCAGCTGACAGTCTTATGC -3'
(R):5'- CCACTTGTCTTGGTTGAACAG -3'
Posted On2020-06-30