Incidental Mutation 'R8120:Cdc5l'
ID631471
Institutional Source Beutler Lab
Gene Symbol Cdc5l
Ensembl Gene ENSMUSG00000023932
Gene Namecell division cycle 5-like (S. pombe)
SynonymsPCDC5RP, 1200002I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8120 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45391892-45433707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45407870 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 607 (T607A)
Ref Sequence ENSEMBL: ENSMUSP00000024727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024727]
Predicted Effect probably benign
Transcript: ENSMUST00000024727
AA Change: T607A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024727
Gene: ENSMUSG00000023932
AA Change: T607A

DomainStartEndE-ValueType
SANT 7 56 4.41e-15 SMART
SANT 59 106 6.29e-11 SMART
coiled coil region 150 181 N/A INTRINSIC
Blast:SANT 187 233 5e-23 BLAST
low complexity region 258 271 N/A INTRINSIC
Pfam:Myb_Cef 404 655 3.1e-85 PFAM
low complexity region 706 718 N/A INTRINSIC
coiled coil region 764 802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,622,890 Q239L probably benign Het
Abca12 T C 1: 71,259,381 I2361V possibly damaging Het
Abcc8 T C 7: 46,136,684 E655G probably benign Het
Ablim1 C T 19: 57,046,928 V662I probably benign Het
Als2cl A C 9: 110,885,392 I103L possibly damaging Het
Arhgef26 A T 3: 62,341,375 D370V probably damaging Het
BC003331 T C 1: 150,384,426 probably null Het
Brwd1 A C 16: 96,019,449 D1292E probably benign Het
Cfhr1 T C 1: 139,547,845 Y296C unknown Het
Cubn A T 2: 13,331,660 C2452S probably damaging Het
D3Ertd254e A T 3: 36,164,491 N221I possibly damaging Het
Dgcr2 A T 16: 17,857,319 Y187* probably null Het
Dhodh G A 8: 109,601,425 T172I probably benign Het
Dnah6 G A 6: 73,025,786 R3876C probably damaging Het
Fam71a T G 1: 191,162,825 Q540H probably damaging Het
Farsb A T 1: 78,462,838 N389K probably benign Het
Fryl T C 5: 73,071,184 T1735A probably benign Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gpcpd1 C T 2: 132,554,023 R136H probably damaging Het
Gpr171 T A 3: 59,097,985 Y123F probably damaging Het
Hcar1 C A 5: 123,879,005 V208F probably damaging Het
Hgf T A 5: 16,613,781 L524M probably damaging Het
Itga2b A T 11: 102,469,542 H57Q probably damaging Het
Itpripl2 G T 7: 118,490,285 N350K probably damaging Het
Limk2 C T 11: 3,348,589 probably null Het
Nae1 A T 8: 104,519,635 V315E probably damaging Het
Nars T C 18: 64,504,351 Y386C probably benign Het
Olfr1346 A T 7: 6,474,120 R3S probably benign Het
Olfr218 C T 1: 173,203,935 T193I probably benign Het
Pcnx3 C T 19: 5,667,546 A1512T probably benign Het
Pde1b A G 15: 103,522,097 D176G possibly damaging Het
Pde4dip T A 3: 97,706,938 T1855S probably null Het
Prr12 A G 7: 45,034,742 Y1625H probably damaging Het
Psmc2 T C 5: 21,800,568 Y216H probably damaging Het
Ptchd3 A T 11: 121,842,208 E641D probably benign Het
Rtf1 A G 2: 119,701,121 T110A probably damaging Het
Rusc1 C A 3: 89,089,206 W690L probably damaging Het
Sardh A G 2: 27,218,851 V624A possibly damaging Het
Slc17a9 G A 2: 180,732,515 G125S probably benign Het
Smpdl3a A T 10: 57,807,451 N219I probably damaging Het
Spo11 G T 2: 172,985,458 D155Y probably damaging Het
Stk38l A G 6: 146,758,601 T44A probably benign Het
Tceanc2 A T 4: 107,177,632 I11N probably benign Het
Tead2 A T 7: 45,216,328 probably benign Het
Tpk1 A G 6: 43,468,996 probably null Het
Ttn T C 2: 76,763,491 N20602D probably damaging Het
Tub T A 7: 109,025,596 probably null Het
Uba2 A T 7: 34,168,387 S42T probably benign Het
Vangl1 T A 3: 102,163,442 R393* probably null Het
Washc3 G A 10: 88,201,297 probably null Het
Wdr78 G A 4: 103,066,334 R433W probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp386 C T 12: 116,054,953 P81S unknown Het
Zw10 A T 9: 49,074,113 E616D probably benign Het
Other mutations in Cdc5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Cdc5l APN 17 45404676 missense probably damaging 0.98
IGL01629:Cdc5l APN 17 45413190 missense probably benign 0.26
IGL02596:Cdc5l APN 17 45424604 splice site probably benign
IGL02973:Cdc5l APN 17 45404647 missense probably benign 0.31
IGL03102:Cdc5l APN 17 45407931 missense probably damaging 0.99
IGL03113:Cdc5l APN 17 45433422 missense possibly damaging 0.47
R0255:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0333:Cdc5l UTSW 17 45393216 splice site probably benign
R0432:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0532:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0551:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0839:Cdc5l UTSW 17 45393147 missense probably benign 0.10
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1483:Cdc5l UTSW 17 45408364 missense possibly damaging 0.79
R1634:Cdc5l UTSW 17 45404706 missense probably damaging 0.99
R1751:Cdc5l UTSW 17 45407805 missense probably benign
R1954:Cdc5l UTSW 17 45426516 splice site probably null
R1955:Cdc5l UTSW 17 45426516 splice site probably null
R2197:Cdc5l UTSW 17 45407819 missense probably benign 0.00
R2229:Cdc5l UTSW 17 45407846 missense probably benign 0.04
R4060:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4061:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4064:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4172:Cdc5l UTSW 17 45419772 missense probably damaging 1.00
R4334:Cdc5l UTSW 17 45410786 missense probably benign 0.00
R5093:Cdc5l UTSW 17 45393041 missense possibly damaging 0.50
R5268:Cdc5l UTSW 17 45415585 missense probably damaging 0.99
R5729:Cdc5l UTSW 17 45426569 missense probably benign 0.39
R6190:Cdc5l UTSW 17 45408017 missense probably benign 0.08
R6462:Cdc5l UTSW 17 45393049 missense probably benign
R6540:Cdc5l UTSW 17 45426644 missense probably damaging 1.00
R7232:Cdc5l UTSW 17 45427937 critical splice donor site probably null
R7381:Cdc5l UTSW 17 45411923 missense probably benign 0.00
R7589:Cdc5l UTSW 17 45410781 missense probably benign 0.41
R8424:Cdc5l UTSW 17 45415600 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCTTTGGTTCGGAGTAGCAATG -3'
(R):5'- TAGGCACAGGATATTGCAGATG -3'

Sequencing Primer
(F):5'- TTCGGAGTAGCAATGTAGCCAC -3'
(R):5'- AGATGTGTCTGATCATTTTGCTTG -3'
Posted On2020-06-30