Incidental Mutation 'R8121:1700003E16Rik'
ID631495
Institutional Source Beutler Lab
Gene Symbol 1700003E16Rik
Ensembl Gene ENSMUSG00000030030
Gene NameRIKEN cDNA 1700003E16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R8121 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83156404-83162945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83161911 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 273 (M273L)
Ref Sequence ENSEMBL: ENSMUSP00000032106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000077407] [ENSMUST00000113913] [ENSMUST00000130212] [ENSMUST00000203203]
Predicted Effect probably benign
Transcript: ENSMUST00000032106
AA Change: M273L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030
AA Change: M273L

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A T 16: 56,631,878 K912N unknown Het
Arfgap2 T C 2: 91,265,683 F62L probably benign Het
Arhgap45 A G 10: 80,018,075 E141G probably damaging Het
Atraid G A 5: 31,054,298 probably null Het
Cd101 G A 3: 101,020,582 A65V probably damaging Het
Cd177 A G 7: 24,759,642 V114A probably benign Het
Cdh6 T C 15: 13,044,671 N455S probably damaging Het
Cdk14 A T 5: 5,227,195 S145T possibly damaging Het
Ces1h T C 8: 93,353,476 E470G unknown Het
Cfap58 A G 19: 48,029,104 Y801C probably benign Het
Clec2d C T 6: 129,184,884 T160M probably benign Het
Cryz A G 3: 154,621,745 I269V probably benign Het
Ctdp1 A T 18: 80,456,008 Y240N probably damaging Het
Dapk1 A G 13: 60,761,398 Y1275C probably damaging Het
Dnah9 A G 11: 66,017,375 I2385T probably benign Het
Dpp8 A G 9: 65,078,080 M807V probably benign Het
Entpd3 T A 9: 120,555,654 I99N probably damaging Het
Fbxw11 A G 11: 32,720,646 E204G possibly damaging Het
Fscn1 T C 5: 142,960,861 M138T probably damaging Het
Gm13101 T A 4: 143,965,041 S371C probably benign Het
Gm5114 T A 7: 39,408,128 Q689L probably benign Het
Iqgap2 T C 13: 95,724,568 N350S probably benign Het
Kcnj10 T A 1: 172,369,242 C108S probably damaging Het
Krtap10-4 G A 10: 77,827,006 R13C unknown Het
Lmo7 T C 14: 101,926,300 I1527T unknown Het
Lrrc17 A G 5: 21,570,331 K297R probably benign Het
Ltb4r1 G A 14: 55,768,122 R294H probably damaging Het
Macc1 A G 12: 119,446,589 D364G probably damaging Het
Mavs A C 2: 131,245,475 T298P probably damaging Het
Myh8 G T 11: 67,289,821 A628S probably benign Het
Neurl4 A T 11: 69,908,230 probably null Het
Nicn1 C A 9: 108,295,105 T213K probably damaging Het
Nptx1 G A 11: 119,542,666 T369I probably damaging Het
Nt5c1a T C 4: 123,208,442 S54P probably damaging Het
Nup210l G A 3: 90,115,121 R132Q probably damaging Het
Olfr1179 A T 2: 88,402,696 F79L probably benign Het
Olfr1287 A G 2: 111,449,160 T7A probably benign Het
Olfr222 A T 11: 59,571,044 I232N probably damaging Het
Olfr837 G A 9: 19,137,692 G233E probably damaging Het
Pip5k1b A T 19: 24,359,991 I311N probably damaging Het
Pkdrej C T 15: 85,815,454 V2094I probably benign Het
Pla2g2f A G 4: 138,752,310 Y179H probably damaging Het
Plekha3 A T 2: 76,686,648 T115S probably damaging Het
Ppp4c A G 7: 126,787,324 L167P probably damaging Het
Rarg A G 15: 102,239,958 I238T probably damaging Het
Scn7a A T 2: 66,700,859 I558N probably damaging Het
Sema3a C A 5: 13,599,247 H655N probably damaging Het
Serpinb6c T C 13: 33,880,218 M285V probably benign Het
Setx T A 2: 29,145,034 S510R possibly damaging Het
Sgcz A G 8: 37,523,303 S299P probably damaging Het
Slc12a2 T A 18: 57,899,331 F368I probably benign Het
Slc7a9 C A 7: 35,454,117 T181K probably damaging Het
Slco2b1 G A 7: 99,685,553 T237M probably benign Het
Spg11 A G 2: 122,069,867 probably null Het
Tbc1d22b G T 17: 29,572,971 G225V probably damaging Het
Tbcd A G 11: 121,597,143 probably null Het
Unc93a T C 17: 13,109,673 Y431C probably benign Het
Vmn1r65 C T 7: 6,008,465 V257I possibly damaging Het
Vmn2r124 A T 17: 18,062,171 T154S probably benign Het
Wnk2 A T 13: 49,060,939 L1487* probably null Het
Zfp853 G A 5: 143,288,263 A549V probably damaging Het
Zfp936 C T 7: 43,190,123 T338I possibly damaging Het
Other mutations in 1700003E16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:1700003E16Rik APN 6 83162788 splice site probably null
IGL02616:1700003E16Rik APN 6 83161662 missense probably benign
IGL03171:1700003E16Rik APN 6 83162395 missense possibly damaging 0.73
IGL03196:1700003E16Rik APN 6 83161063 missense probably damaging 1.00
R0124:1700003E16Rik UTSW 6 83161674 missense probably benign
R1081:1700003E16Rik UTSW 6 83162020 missense probably benign
R1184:1700003E16Rik UTSW 6 83160912 missense probably damaging 1.00
R1522:1700003E16Rik UTSW 6 83162586 missense probably damaging 0.96
R4361:1700003E16Rik UTSW 6 83162706 missense probably damaging 0.99
R4688:1700003E16Rik UTSW 6 83162698 missense probably damaging 0.99
R5326:1700003E16Rik UTSW 6 83161354 missense probably damaging 0.99
R6007:1700003E16Rik UTSW 6 83160918 missense possibly damaging 0.80
R7212:1700003E16Rik UTSW 6 83161672 missense probably benign 0.00
R7343:1700003E16Rik UTSW 6 83162371 missense probably benign 0.12
R8081:1700003E16Rik UTSW 6 83161331 missense probably damaging 1.00
Z1176:1700003E16Rik UTSW 6 83161115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGAGGGAAGCCATATGTTG -3'
(R):5'- TTCCAAAGGGTGCACTTCG -3'

Sequencing Primer
(F):5'- GGCTGTGCCCTCGAAGGAG -3'
(R):5'- GAATCCATGCGCAACGTG -3'
Posted On2020-06-30