Incidental Mutation 'R8121:Serpinb6c'
ID 631518
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8121 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33880218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 285 (M285V)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184]
AlphaFold W4VSP4
Predicted Effect probably benign
Transcript: ENSMUST00000110273
AA Change: M285V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: M285V

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172184
AA Change: M285V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: M285V

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,911 M273L probably benign Het
Abi3bp A T 16: 56,631,878 K912N unknown Het
Arfgap2 T C 2: 91,265,683 F62L probably benign Het
Arhgap45 A G 10: 80,018,075 E141G probably damaging Het
Atraid G A 5: 31,054,298 probably null Het
Cd101 G A 3: 101,020,582 A65V probably damaging Het
Cd177 A G 7: 24,759,642 V114A probably benign Het
Cdh6 T C 15: 13,044,671 N455S probably damaging Het
Cdk14 A T 5: 5,227,195 S145T possibly damaging Het
Ces1h T C 8: 93,353,476 E470G unknown Het
Cfap58 A G 19: 48,029,104 Y801C probably benign Het
Clec2d C T 6: 129,184,884 T160M probably benign Het
Cryz A G 3: 154,621,745 I269V probably benign Het
Ctdp1 A T 18: 80,456,008 Y240N probably damaging Het
Dapk1 A G 13: 60,761,398 Y1275C probably damaging Het
Dnah9 A G 11: 66,017,375 I2385T probably benign Het
Dpp8 A G 9: 65,078,080 M807V probably benign Het
Entpd3 T A 9: 120,555,654 I99N probably damaging Het
Fbxw11 A G 11: 32,720,646 E204G possibly damaging Het
Fscn1 T C 5: 142,960,861 M138T probably damaging Het
Gm13101 T A 4: 143,965,041 S371C probably benign Het
Gm5114 T A 7: 39,408,128 Q689L probably benign Het
Iqgap2 T C 13: 95,724,568 N350S probably benign Het
Kcnj10 T A 1: 172,369,242 C108S probably damaging Het
Krtap10-4 G A 10: 77,827,006 R13C unknown Het
Lmo7 T C 14: 101,926,300 I1527T unknown Het
Lrrc17 A G 5: 21,570,331 K297R probably benign Het
Ltb4r1 G A 14: 55,768,122 R294H probably damaging Het
Macc1 A G 12: 119,446,589 D364G probably damaging Het
Mavs A C 2: 131,245,475 T298P probably damaging Het
Myh8 G T 11: 67,289,821 A628S probably benign Het
Neurl4 A T 11: 69,908,230 probably null Het
Nicn1 C A 9: 108,295,105 T213K probably damaging Het
Nptx1 G A 11: 119,542,666 T369I probably damaging Het
Nt5c1a T C 4: 123,208,442 S54P probably damaging Het
Nup210l G A 3: 90,115,121 R132Q probably damaging Het
Olfr1179 A T 2: 88,402,696 F79L probably benign Het
Olfr1287 A G 2: 111,449,160 T7A probably benign Het
Olfr222 A T 11: 59,571,044 I232N probably damaging Het
Olfr837 G A 9: 19,137,692 G233E probably damaging Het
Pip5k1b A T 19: 24,359,991 I311N probably damaging Het
Pkdrej C T 15: 85,815,454 V2094I probably benign Het
Pla2g2f A G 4: 138,752,310 Y179H probably damaging Het
Plekha3 A T 2: 76,686,648 T115S probably damaging Het
Ppp4c A G 7: 126,787,324 L167P probably damaging Het
Rarg A G 15: 102,239,958 I238T probably damaging Het
Scn7a A T 2: 66,700,859 I558N probably damaging Het
Sema3a C A 5: 13,599,247 H655N probably damaging Het
Setx T A 2: 29,145,034 S510R possibly damaging Het
Sgcz A G 8: 37,523,303 S299P probably damaging Het
Slc12a2 T A 18: 57,899,331 F368I probably benign Het
Slc7a9 C A 7: 35,454,117 T181K probably damaging Het
Slco2b1 G A 7: 99,685,553 T237M probably benign Het
Spg11 A G 2: 122,069,867 probably null Het
Tbc1d22b G T 17: 29,572,971 G225V probably damaging Het
Tbcd A G 11: 121,597,143 probably null Het
Unc93a T C 17: 13,109,673 Y431C probably benign Het
Vmn1r65 C T 7: 6,008,465 V257I possibly damaging Het
Vmn2r124 A T 17: 18,062,171 T154S probably benign Het
Wnk2 A T 13: 49,060,939 L1487* probably null Het
Zfp853 G A 5: 143,288,263 A549V probably damaging Het
Zfp936 C T 7: 43,190,123 T338I possibly damaging Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
R8855:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R8866:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R9412:Serpinb6c UTSW 13 33897388 missense probably benign 0.00
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTGATGACCCCTTCAGAAC -3'
(R):5'- AAGATATAGCCACAGTTCCCTGG -3'

Sequencing Primer
(F):5'- GACCCCTTCAGAACAATTGTAGTGG -3'
(R):5'- GGCAGTGTAGAACCTTCCCATTG -3'
Posted On 2020-06-30