Incidental Mutation 'R8121:Iqgap2'
ID631521
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8121 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95724568 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 350 (N350S)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably benign
Transcript: ENSMUST00000068603
AA Change: N350S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: N350S

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,911 M273L probably benign Het
Abi3bp A T 16: 56,631,878 K912N unknown Het
Arfgap2 T C 2: 91,265,683 F62L probably benign Het
Arhgap45 A G 10: 80,018,075 E141G probably damaging Het
Atraid G A 5: 31,054,298 probably null Het
Cd101 G A 3: 101,020,582 A65V probably damaging Het
Cd177 A G 7: 24,759,642 V114A probably benign Het
Cdh6 T C 15: 13,044,671 N455S probably damaging Het
Cdk14 A T 5: 5,227,195 S145T possibly damaging Het
Ces1h T C 8: 93,353,476 E470G unknown Het
Cfap58 A G 19: 48,029,104 Y801C probably benign Het
Clec2d C T 6: 129,184,884 T160M probably benign Het
Cryz A G 3: 154,621,745 I269V probably benign Het
Ctdp1 A T 18: 80,456,008 Y240N probably damaging Het
Dapk1 A G 13: 60,761,398 Y1275C probably damaging Het
Dnah9 A G 11: 66,017,375 I2385T probably benign Het
Dpp8 A G 9: 65,078,080 M807V probably benign Het
Entpd3 T A 9: 120,555,654 I99N probably damaging Het
Fbxw11 A G 11: 32,720,646 E204G possibly damaging Het
Fscn1 T C 5: 142,960,861 M138T probably damaging Het
Gm13101 T A 4: 143,965,041 S371C probably benign Het
Gm5114 T A 7: 39,408,128 Q689L probably benign Het
Kcnj10 T A 1: 172,369,242 C108S probably damaging Het
Krtap10-4 G A 10: 77,827,006 R13C unknown Het
Lmo7 T C 14: 101,926,300 I1527T unknown Het
Lrrc17 A G 5: 21,570,331 K297R probably benign Het
Ltb4r1 G A 14: 55,768,122 R294H probably damaging Het
Macc1 A G 12: 119,446,589 D364G probably damaging Het
Mavs A C 2: 131,245,475 T298P probably damaging Het
Myh8 G T 11: 67,289,821 A628S probably benign Het
Neurl4 A T 11: 69,908,230 probably null Het
Nicn1 C A 9: 108,295,105 T213K probably damaging Het
Nptx1 G A 11: 119,542,666 T369I probably damaging Het
Nt5c1a T C 4: 123,208,442 S54P probably damaging Het
Nup210l G A 3: 90,115,121 R132Q probably damaging Het
Olfr1179 A T 2: 88,402,696 F79L probably benign Het
Olfr1287 A G 2: 111,449,160 T7A probably benign Het
Olfr222 A T 11: 59,571,044 I232N probably damaging Het
Olfr837 G A 9: 19,137,692 G233E probably damaging Het
Pip5k1b A T 19: 24,359,991 I311N probably damaging Het
Pkdrej C T 15: 85,815,454 V2094I probably benign Het
Pla2g2f A G 4: 138,752,310 Y179H probably damaging Het
Plekha3 A T 2: 76,686,648 T115S probably damaging Het
Ppp4c A G 7: 126,787,324 L167P probably damaging Het
Rarg A G 15: 102,239,958 I238T probably damaging Het
Scn7a A T 2: 66,700,859 I558N probably damaging Het
Sema3a C A 5: 13,599,247 H655N probably damaging Het
Serpinb6c T C 13: 33,880,218 M285V probably benign Het
Setx T A 2: 29,145,034 S510R possibly damaging Het
Sgcz A G 8: 37,523,303 S299P probably damaging Het
Slc12a2 T A 18: 57,899,331 F368I probably benign Het
Slc7a9 C A 7: 35,454,117 T181K probably damaging Het
Slco2b1 G A 7: 99,685,553 T237M probably benign Het
Spg11 A G 2: 122,069,867 probably null Het
Tbc1d22b G T 17: 29,572,971 G225V probably damaging Het
Tbcd A G 11: 121,597,143 probably null Het
Unc93a T C 17: 13,109,673 Y431C probably benign Het
Vmn1r65 C T 7: 6,008,465 V257I possibly damaging Het
Vmn2r124 A T 17: 18,062,171 T154S probably benign Het
Wnk2 A T 13: 49,060,939 L1487* probably null Het
Zfp853 G A 5: 143,288,263 A549V probably damaging Het
Zfp936 C T 7: 43,190,123 T338I possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGGAAACTAAACCCTGGGACTG -3'
(R):5'- TGCATCAGGACCTTGGGAAG -3'

Sequencing Primer
(F):5'- TAAACCCTGGGACTGGCACC -3'
(R):5'- GAGGAAAGCATACATTCTCACTTAG -3'
Posted On2020-06-30