Incidental Mutation 'R8121:Pkdrej'
ID631525
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8121 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85815454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2094 (V2094I)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370] [ENSMUST00000071876] [ENSMUST00000125947] [ENSMUST00000134631] [ENSMUST00000144067] [ENSMUST00000150995] [ENSMUST00000154814]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: V2094I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: V2094I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071876
SMART Domains Protein: ENSMUSP00000071772
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 106 3.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125947
SMART Domains Protein: ENSMUSP00000114528
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134631
SMART Domains Protein: ENSMUSP00000121889
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144067
SMART Domains Protein: ENSMUSP00000119728
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150995
SMART Domains Protein: ENSMUSP00000123174
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154814
SMART Domains Protein: ENSMUSP00000116823
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 78 1e-35 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A T 6: 83,161,911 M273L probably benign Het
Abi3bp A T 16: 56,631,878 K912N unknown Het
Arfgap2 T C 2: 91,265,683 F62L probably benign Het
Arhgap45 A G 10: 80,018,075 E141G probably damaging Het
Atraid G A 5: 31,054,298 probably null Het
Cd101 G A 3: 101,020,582 A65V probably damaging Het
Cd177 A G 7: 24,759,642 V114A probably benign Het
Cdh6 T C 15: 13,044,671 N455S probably damaging Het
Cdk14 A T 5: 5,227,195 S145T possibly damaging Het
Ces1h T C 8: 93,353,476 E470G unknown Het
Cfap58 A G 19: 48,029,104 Y801C probably benign Het
Clec2d C T 6: 129,184,884 T160M probably benign Het
Cryz A G 3: 154,621,745 I269V probably benign Het
Ctdp1 A T 18: 80,456,008 Y240N probably damaging Het
Dapk1 A G 13: 60,761,398 Y1275C probably damaging Het
Dnah9 A G 11: 66,017,375 I2385T probably benign Het
Dpp8 A G 9: 65,078,080 M807V probably benign Het
Entpd3 T A 9: 120,555,654 I99N probably damaging Het
Fbxw11 A G 11: 32,720,646 E204G possibly damaging Het
Fscn1 T C 5: 142,960,861 M138T probably damaging Het
Gm13101 T A 4: 143,965,041 S371C probably benign Het
Gm5114 T A 7: 39,408,128 Q689L probably benign Het
Iqgap2 T C 13: 95,724,568 N350S probably benign Het
Kcnj10 T A 1: 172,369,242 C108S probably damaging Het
Krtap10-4 G A 10: 77,827,006 R13C unknown Het
Lmo7 T C 14: 101,926,300 I1527T unknown Het
Lrrc17 A G 5: 21,570,331 K297R probably benign Het
Ltb4r1 G A 14: 55,768,122 R294H probably damaging Het
Macc1 A G 12: 119,446,589 D364G probably damaging Het
Mavs A C 2: 131,245,475 T298P probably damaging Het
Myh8 G T 11: 67,289,821 A628S probably benign Het
Neurl4 A T 11: 69,908,230 probably null Het
Nicn1 C A 9: 108,295,105 T213K probably damaging Het
Nptx1 G A 11: 119,542,666 T369I probably damaging Het
Nt5c1a T C 4: 123,208,442 S54P probably damaging Het
Nup210l G A 3: 90,115,121 R132Q probably damaging Het
Olfr1179 A T 2: 88,402,696 F79L probably benign Het
Olfr1287 A G 2: 111,449,160 T7A probably benign Het
Olfr222 A T 11: 59,571,044 I232N probably damaging Het
Olfr837 G A 9: 19,137,692 G233E probably damaging Het
Pip5k1b A T 19: 24,359,991 I311N probably damaging Het
Pla2g2f A G 4: 138,752,310 Y179H probably damaging Het
Plekha3 A T 2: 76,686,648 T115S probably damaging Het
Ppp4c A G 7: 126,787,324 L167P probably damaging Het
Rarg A G 15: 102,239,958 I238T probably damaging Het
Scn7a A T 2: 66,700,859 I558N probably damaging Het
Sema3a C A 5: 13,599,247 H655N probably damaging Het
Serpinb6c T C 13: 33,880,218 M285V probably benign Het
Setx T A 2: 29,145,034 S510R possibly damaging Het
Sgcz A G 8: 37,523,303 S299P probably damaging Het
Slc12a2 T A 18: 57,899,331 F368I probably benign Het
Slc7a9 C A 7: 35,454,117 T181K probably damaging Het
Slco2b1 G A 7: 99,685,553 T237M probably benign Het
Spg11 A G 2: 122,069,867 probably null Het
Tbc1d22b G T 17: 29,572,971 G225V probably damaging Het
Tbcd A G 11: 121,597,143 probably null Het
Unc93a T C 17: 13,109,673 Y431C probably benign Het
Vmn1r65 C T 7: 6,008,465 V257I possibly damaging Het
Vmn2r124 A T 17: 18,062,171 T154S probably benign Het
Wnk2 A T 13: 49,060,939 L1487* probably null Het
Zfp853 G A 5: 143,288,263 A549V probably damaging Het
Zfp936 C T 7: 43,190,123 T338I possibly damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 splice site probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R8140:Pkdrej UTSW 15 85818410 missense probably damaging 1.00
R8219:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
R8222:Pkdrej UTSW 15 85817439 missense probably benign
R8432:Pkdrej UTSW 15 85817293 missense probably benign 0.00
R8755:Pkdrej UTSW 15 85819606 missense probably benign 0.00
R8786:Pkdrej UTSW 15 85819843 missense probably benign 0.01
R8817:Pkdrej UTSW 15 85818573 missense probably damaging 1.00
R8827:Pkdrej UTSW 15 85815531 missense possibly damaging 0.76
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCACTCTTTAGTCCCCTTGAG -3'
(R):5'- TTCCGGCAACAAGGTTCTC -3'

Sequencing Primer
(F):5'- GTCCCCTTGAGAAACATAAGTCATG -3'
(R):5'- AACAAGGTTCTCGGGGTCCTG -3'
Posted On2020-06-30