Incidental Mutation 'R8122:Olfr955'
ID631553
Institutional Source Beutler Lab
Gene Symbol Olfr955
Ensembl Gene ENSMUSG00000063176
Gene Nameolfactory receptor 955
SynonymsMOR171-50, GA_x6K02T2PVTD-33167297-33166353, MOR171-34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8122 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39465801-39471944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39470526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000151246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073946] [ENSMUST00000220176]
Predicted Effect probably damaging
Transcript: ENSMUST00000073946
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073602
Gene: ENSMUSG00000063176
AA Change: S67P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220176
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,886,670 V672E possibly damaging Het
Abat A G 16: 8,615,897 Y426C probably damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Amer2 A T 14: 60,379,342 M329L possibly damaging Het
Arhgap20 A G 9: 51,849,993 N1048S probably damaging Het
Asah1 T C 8: 41,343,730 E305G probably benign Het
AW551984 T A 9: 39,599,369 K223N probably damaging Het
BC067074 A T 13: 113,318,908 D496V Het
Bptf C A 11: 107,036,591 probably null Het
C1qtnf6 T C 15: 78,527,246 N77D probably benign Het
Capn13 T A 17: 73,367,210 I83F probably damaging Het
Cd6 A G 19: 10,792,867 F487L probably damaging Het
Cit T C 5: 115,969,010 V1067A probably damaging Het
Csrnp1 T C 9: 119,973,207 D262G probably damaging Het
Cyp2d11 T A 15: 82,392,543 Q65L probably benign Het
Dbt T A 3: 116,520,242 C19* probably null Het
Dgkg A C 16: 22,566,545 probably null Het
Eif4g2 T C 7: 111,078,553 I118V possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Kcnn2 T G 18: 45,676,938 V414G probably damaging Het
Lama2 G A 10: 27,054,596 H2055Y possibly damaging Het
Loxl3 T A 6: 83,049,259 W443R probably damaging Het
Mab21l1 A T 3: 55,783,484 D164V probably benign Het
Mroh7 T C 4: 106,702,529 T734A probably damaging Het
Olfr1392 C A 11: 49,293,574 N84K probably damaging Het
Pkhd1 C T 1: 20,562,458 E578K probably damaging Het
Pld2 T A 11: 70,541,433 L126* probably null Het
Polk A T 13: 96,483,783 N716K probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prom1 T C 5: 44,012,953 K669E probably benign Het
Sag A G 1: 87,834,567 D318G probably damaging Het
Scfd1 T A 12: 51,433,269 V528E possibly damaging Het
Scn4a A G 11: 106,330,331 L834P probably benign Het
Shank1 G T 7: 44,333,591 G637V unknown Het
Slc12a6 A G 2: 112,266,822 M1V probably null Het
St6gal1 A G 16: 23,354,894 K242R probably benign Het
Syt3 A G 7: 44,395,729 Y495C probably damaging Het
Taar8c C T 10: 24,101,209 S235N probably benign Het
Tmem183a A T 1: 134,354,765 C201S probably benign Het
Top2a T C 11: 98,999,167 I1237V probably benign Het
Trub1 G T 19: 57,485,131 V207L probably benign Het
Ttll13 T A 7: 80,259,469 I634N probably benign Het
Ube2j1 T G 4: 33,045,145 N208K probably benign Het
Wdr17 A G 8: 54,664,976 S569P probably damaging Het
Other mutations in Olfr955
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr955 APN 9 39470243 missense probably benign 0.00
IGL02550:Olfr955 APN 9 39470546 missense probably benign 0.42
IGL02743:Olfr955 APN 9 39470246 missense probably benign 0.10
R0029:Olfr955 UTSW 9 39470660 missense probably benign 0.06
R0329:Olfr955 UTSW 9 39470556 missense possibly damaging 0.52
R0610:Olfr955 UTSW 9 39469823 missense probably damaging 0.98
R1420:Olfr955 UTSW 9 39469993 missense probably damaging 1.00
R1636:Olfr955 UTSW 9 39469919 missense probably benign 0.03
R1937:Olfr955 UTSW 9 39470037 missense possibly damaging 0.63
R2655:Olfr955 UTSW 9 39470628 missense probably benign
R2944:Olfr955 UTSW 9 39469938 missense possibly damaging 0.52
R3788:Olfr955 UTSW 9 39470069 missense probably benign 0.03
R4829:Olfr955 UTSW 9 39470367 missense probably damaging 0.99
R5625:Olfr955 UTSW 9 39469803 missense probably benign
R6168:Olfr955 UTSW 9 39470657 missense probably damaging 1.00
R6383:Olfr955 UTSW 9 39470630 missense probably damaging 1.00
R6418:Olfr955 UTSW 9 39469816 missense probably benign 0.07
R6645:Olfr955 UTSW 9 39470266 missense probably benign 0.03
R7062:Olfr955 UTSW 9 39470057 missense probably benign
R7765:Olfr955 UTSW 9 39470316 missense probably benign 0.28
R7847:Olfr955 UTSW 9 39470505 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGGCACTGATTAAGCCAATACC -3'
(R):5'- AGTGACAGAGTTCATTCTTGCTG -3'

Sequencing Primer
(F):5'- GATATAGCCACATAGCGGTCATATGC -3'
(R):5'- CTGGTTTAACAGAGAATCCAGAGCTC -3'
Posted On2020-06-30