Incidental Mutation 'R8122:Scn4a'
ID631562
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8122 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106330331 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 834 (L834P)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
AA Change: L834P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: L834P

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,886,670 V672E possibly damaging Het
Abat A G 16: 8,615,897 Y426C probably damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Amer2 A T 14: 60,379,342 M329L possibly damaging Het
Arhgap20 A G 9: 51,849,993 N1048S probably damaging Het
Asah1 T C 8: 41,343,730 E305G probably benign Het
AW551984 T A 9: 39,599,369 K223N probably damaging Het
BC067074 A T 13: 113,318,908 D496V Het
Bptf C A 11: 107,036,591 probably null Het
C1qtnf6 T C 15: 78,527,246 N77D probably benign Het
Capn13 T A 17: 73,367,210 I83F probably damaging Het
Cd6 A G 19: 10,792,867 F487L probably damaging Het
Cit T C 5: 115,969,010 V1067A probably damaging Het
Csrnp1 T C 9: 119,973,207 D262G probably damaging Het
Cyp2d11 T A 15: 82,392,543 Q65L probably benign Het
Dbt T A 3: 116,520,242 C19* probably null Het
Dgkg A C 16: 22,566,545 probably null Het
Eif4g2 T C 7: 111,078,553 I118V possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Kcnn2 T G 18: 45,676,938 V414G probably damaging Het
Lama2 G A 10: 27,054,596 H2055Y possibly damaging Het
Loxl3 T A 6: 83,049,259 W443R probably damaging Het
Mab21l1 A T 3: 55,783,484 D164V probably benign Het
Mroh7 T C 4: 106,702,529 T734A probably damaging Het
Olfr1392 C A 11: 49,293,574 N84K probably damaging Het
Olfr955 A G 9: 39,470,526 S67P probably damaging Het
Pkhd1 C T 1: 20,562,458 E578K probably damaging Het
Pld2 T A 11: 70,541,433 L126* probably null Het
Polk A T 13: 96,483,783 N716K probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prom1 T C 5: 44,012,953 K669E probably benign Het
Sag A G 1: 87,834,567 D318G probably damaging Het
Scfd1 T A 12: 51,433,269 V528E possibly damaging Het
Shank1 G T 7: 44,333,591 G637V unknown Het
Slc12a6 A G 2: 112,266,822 M1V probably null Het
St6gal1 A G 16: 23,354,894 K242R probably benign Het
Syt3 A G 7: 44,395,729 Y495C probably damaging Het
Taar8c C T 10: 24,101,209 S235N probably benign Het
Tmem183a A T 1: 134,354,765 C201S probably benign Het
Top2a T C 11: 98,999,167 I1237V probably benign Het
Trub1 G T 19: 57,485,131 V207L probably benign Het
Ttll13 T A 7: 80,259,469 I634N probably benign Het
Ube2j1 T G 4: 33,045,145 N208K probably benign Het
Wdr17 A G 8: 54,664,976 S569P probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGGTGGTCCATCTCGATGC -3'
(R):5'- ATGAATGAAGGTGGTATCCCC -3'

Sequencing Primer
(F):5'- TCCATCTCGATGCTGGAGC -3'
(R):5'- ATGAAGGTGGTATCCCCCAGAC -3'
Posted On2020-06-30