Incidental Mutation 'R8122:Scfd1'
ID631564
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene NameSec1 family domain containing 1
Synonyms3110021P21Rik, RA410, STXBP1L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R8122 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51377510-51450101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51433269 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 528 (V528E)
Ref Sequence ENSEMBL: ENSMUSP00000021335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021335
AA Change: V528E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952
AA Change: V528E

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,886,670 V672E possibly damaging Het
Abat A G 16: 8,615,897 Y426C probably damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Amer2 A T 14: 60,379,342 M329L possibly damaging Het
Arhgap20 A G 9: 51,849,993 N1048S probably damaging Het
Asah1 T C 8: 41,343,730 E305G probably benign Het
AW551984 T A 9: 39,599,369 K223N probably damaging Het
BC067074 A T 13: 113,318,908 D496V Het
Bptf C A 11: 107,036,591 probably null Het
C1qtnf6 T C 15: 78,527,246 N77D probably benign Het
Capn13 T A 17: 73,367,210 I83F probably damaging Het
Cd6 A G 19: 10,792,867 F487L probably damaging Het
Cit T C 5: 115,969,010 V1067A probably damaging Het
Csrnp1 T C 9: 119,973,207 D262G probably damaging Het
Cyp2d11 T A 15: 82,392,543 Q65L probably benign Het
Dbt T A 3: 116,520,242 C19* probably null Het
Dgkg A C 16: 22,566,545 probably null Het
Eif4g2 T C 7: 111,078,553 I118V possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Kcnn2 T G 18: 45,676,938 V414G probably damaging Het
Lama2 G A 10: 27,054,596 H2055Y possibly damaging Het
Loxl3 T A 6: 83,049,259 W443R probably damaging Het
Mab21l1 A T 3: 55,783,484 D164V probably benign Het
Mroh7 T C 4: 106,702,529 T734A probably damaging Het
Olfr1392 C A 11: 49,293,574 N84K probably damaging Het
Olfr955 A G 9: 39,470,526 S67P probably damaging Het
Pkhd1 C T 1: 20,562,458 E578K probably damaging Het
Pld2 T A 11: 70,541,433 L126* probably null Het
Polk A T 13: 96,483,783 N716K probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prom1 T C 5: 44,012,953 K669E probably benign Het
Sag A G 1: 87,834,567 D318G probably damaging Het
Scn4a A G 11: 106,330,331 L834P probably benign Het
Shank1 G T 7: 44,333,591 G637V unknown Het
Slc12a6 A G 2: 112,266,822 M1V probably null Het
St6gal1 A G 16: 23,354,894 K242R probably benign Het
Syt3 A G 7: 44,395,729 Y495C probably damaging Het
Taar8c C T 10: 24,101,209 S235N probably benign Het
Tmem183a A T 1: 134,354,765 C201S probably benign Het
Top2a T C 11: 98,999,167 I1237V probably benign Het
Trub1 G T 19: 57,485,131 V207L probably benign Het
Ttll13 T A 7: 80,259,469 I634N probably benign Het
Ube2j1 T G 4: 33,045,145 N208K probably benign Het
Wdr17 A G 8: 54,664,976 S569P probably damaging Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51427869 missense probably benign 0.01
IGL00640:Scfd1 APN 12 51389315 missense probably benign 0.12
IGL01481:Scfd1 APN 12 51384120 missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51415553 missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51445711 missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51414117 missense probably benign 0.03
IGL02226:Scfd1 APN 12 51389381 splice site probably benign
IGL02327:Scfd1 APN 12 51389317 missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51422921 missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51387107 missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51422973 missense probably benign 0.01
R0671:Scfd1 UTSW 12 51412628 missense probably benign 0.01
R0707:Scfd1 UTSW 12 51412577 missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51422986 missense probably benign 0.00
R2173:Scfd1 UTSW 12 51387079 missense probably benign 0.22
R2249:Scfd1 UTSW 12 51415516 missense possibly damaging 0.48
R3872:Scfd1 UTSW 12 51392196 missense probably damaging 0.98
R4080:Scfd1 UTSW 12 51431519 missense probably benign
R4356:Scfd1 UTSW 12 51439285 missense probably benign 0.00
R4841:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51390412 missense probably benign 0.00
R5004:Scfd1 UTSW 12 51444994 missense probably benign 0.03
R5275:Scfd1 UTSW 12 51415589 missense probably benign 0.19
R5494:Scfd1 UTSW 12 51396739 splice site probably null
R5779:Scfd1 UTSW 12 51431529 missense probably benign
R6000:Scfd1 UTSW 12 51445674 missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51445678 missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51431541 missense probably benign 0.04
R6954:Scfd1 UTSW 12 51427946 critical splice donor site probably null
R7748:Scfd1 UTSW 12 51389357 missense probably benign 0.21
R7993:Scfd1 UTSW 12 51445707 missense probably damaging 1.00
R8353:Scfd1 UTSW 12 51412591 missense possibly damaging 0.91
R8453:Scfd1 UTSW 12 51412591 missense possibly damaging 0.91
RF007:Scfd1 UTSW 12 51422973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCAGCAATGATATCCATGG -3'
(R):5'- AGAAGTCTTATTTCCCTACTATGCC -3'

Sequencing Primer
(F):5'- TCCATGGAAGTAGAAATGTTCACAGC -3'
(R):5'- GCCAATAAGGATCCTTTGGTTC -3'
Posted On2020-06-30