Incidental Mutation 'R8122:Abat'
ID631575
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8122 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8615897 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 426 (Y426C)
Ref Sequence ENSEMBL: ENSMUSP00000063548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115839]
Predicted Effect probably damaging
Transcript: ENSMUST00000065987
AA Change: Y426C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880
AA Change: Y426C

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
AA Change: Y370C

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880
AA Change: Y370C

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,886,670 V672E possibly damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Amer2 A T 14: 60,379,342 M329L possibly damaging Het
Arhgap20 A G 9: 51,849,993 N1048S probably damaging Het
Asah1 T C 8: 41,343,730 E305G probably benign Het
AW551984 T A 9: 39,599,369 K223N probably damaging Het
BC067074 A T 13: 113,318,908 D496V Het
Bptf C A 11: 107,036,591 probably null Het
C1qtnf6 T C 15: 78,527,246 N77D probably benign Het
Capn13 T A 17: 73,367,210 I83F probably damaging Het
Cd6 A G 19: 10,792,867 F487L probably damaging Het
Cit T C 5: 115,969,010 V1067A probably damaging Het
Csrnp1 T C 9: 119,973,207 D262G probably damaging Het
Cyp2d11 T A 15: 82,392,543 Q65L probably benign Het
Dbt T A 3: 116,520,242 C19* probably null Het
Eif4g2 T C 7: 111,078,553 I118V possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Kcnn2 T G 18: 45,676,938 V414G probably damaging Het
Lama2 G A 10: 27,054,596 H2055Y possibly damaging Het
Loxl3 T A 6: 83,049,259 W443R probably damaging Het
Mab21l1 A T 3: 55,783,484 D164V probably benign Het
Mroh7 T C 4: 106,702,529 T734A probably damaging Het
Olfr1392 C A 11: 49,293,574 N84K probably damaging Het
Olfr955 A G 9: 39,470,526 S67P probably damaging Het
Pkhd1 C T 1: 20,562,458 E578K probably damaging Het
Pld2 T A 11: 70,541,433 L126* probably null Het
Polk A T 13: 96,483,783 N716K probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prom1 T C 5: 44,012,953 K669E probably benign Het
Sag A G 1: 87,834,567 D318G probably damaging Het
Scfd1 T A 12: 51,433,269 V528E possibly damaging Het
Scn4a A G 11: 106,330,331 L834P probably benign Het
Shank1 G T 7: 44,333,591 G637V unknown Het
Slc12a6 A G 2: 112,266,822 M1V probably null Het
St6gal1 A G 16: 23,354,894 K242R probably benign Het
Syt3 A G 7: 44,395,729 Y495C probably damaging Het
Taar8c C T 10: 24,101,209 S235N probably benign Het
Tmem183a A T 1: 134,354,765 C201S probably benign Het
Top2a T C 11: 98,999,167 I1237V probably benign Het
Trub1 G T 19: 57,485,131 V207L probably benign Het
Ttll13 T A 7: 80,259,469 I634N probably benign Het
Ube2j1 T G 4: 33,045,145 N208K probably benign Het
Wdr17 A G 8: 54,664,976 S569P probably damaging Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
R8138:Abat UTSW 16 8600965 missense probably benign 0.05
Z1177:Abat UTSW 16 8603753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGTGTAGGGAAATGCCAG -3'
(R):5'- CTTAGCATCCCTGGGAGAGTAGAC -3'

Sequencing Primer
(F):5'- CCTGGAAAGGGGAAAACATTTG -3'
(R):5'- TCCCTGGGAGAGTAGACGTCAG -3'
Posted On2020-06-30