Incidental Mutation 'R8123:Spata3'
ID631584
Institutional Source Beutler Lab
Gene Symbol Spata3
Ensembl Gene ENSMUSG00000026226
Gene Namespermatogenesis associated 3
Synonyms1700029H01Rik, TSARG1, 1700011N12Rik, 4930424D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8123 (G1)
Quality Score162.009
Status Validated
Chromosome1
Chromosomal Location86016816-86029958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86024353 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 110 (R110C)
Ref Sequence ENSEMBL: ENSMUSP00000050509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052854] [ENSMUST00000113344] [ENSMUST00000125083] [ENSMUST00000130504] [ENSMUST00000135440] [ENSMUST00000149469] [ENSMUST00000152501] [ENSMUST00000153247] [ENSMUST00000159876]
Predicted Effect unknown
Transcript: ENSMUST00000052854
AA Change: R110C
SMART Domains Protein: ENSMUSP00000050509
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
low complexity region 169 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113344
AA Change: R109C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108971
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 168 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125083
SMART Domains Protein: ENSMUSP00000120768
Gene: ENSMUSG00000026226

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130504
AA Change: R109C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116903
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 168 190 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123844
Gene: ENSMUSG00000026226
AA Change: R90C

DomainStartEndE-ValueType
Pfam:SPATA3 1 173 8.4e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135440
AA Change: R110C
SMART Domains Protein: ENSMUSP00000123587
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149469
AA Change: R250C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000152501
AA Change: R109C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123194
Gene: ENSMUSG00000026226
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153247
SMART Domains Protein: ENSMUSP00000117650
Gene: ENSMUSG00000026226

DomainStartEndE-ValueType
low complexity region 2 52 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159876
AA Change: R110C
SMART Domains Protein: ENSMUSP00000124671
Gene: ENSMUSG00000026226
AA Change: R110C

DomainStartEndE-ValueType
Pfam:SPATA3 1 192 1.1e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Spata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Spata3 APN 1 86022308 missense possibly damaging 0.51
IGL02553:Spata3 APN 1 86024489 missense probably damaging 1.00
IGL02736:Spata3 APN 1 86024435 missense probably damaging 0.98
PIT4696001:Spata3 UTSW 1 86024447 missense unknown
R1930:Spata3 UTSW 1 86022061 intron probably benign
R1931:Spata3 UTSW 1 86022061 intron probably benign
R4472:Spata3 UTSW 1 86026430 missense probably benign 0.05
R4579:Spata3 UTSW 1 86026453 missense probably damaging 0.97
R4824:Spata3 UTSW 1 86024326 critical splice acceptor site probably null
R7823:Spata3 UTSW 1 86022059 intron probably benign
R8062:Spata3 UTSW 1 86024426 missense unknown
R8124:Spata3 UTSW 1 86024353 missense unknown
R8125:Spata3 UTSW 1 86024353 missense unknown
R8126:Spata3 UTSW 1 86024353 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGATGTCCCACTGATGCC -3'
(R):5'- AACCAGATCTGAGGACCGAG -3'

Sequencing Primer
(F):5'- TGATGCCCTACAACACCTGCTAG -3'
(R):5'- GGAACTCTACACCCAAGGCTTTTTAG -3'
Posted On2020-06-30