Incidental Mutation 'R8123:Fcgr4'
ID631587
Institutional Source Beutler Lab
Gene Symbol Fcgr4
Ensembl Gene ENSMUSG00000059089
Gene NameFc receptor, IgG, low affinity IV
Synonyms4833442P21Rik, FcgammaRIV, Fcgr3a, CD16-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171018920-171029761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171020003 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 57 (I57V)
Ref Sequence ENSEMBL: ENSMUSP00000077873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078825]
Predicted Effect probably benign
Transcript: ENSMUST00000078825
AA Change: I57V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077873
Gene: ENSMUSG00000059089
AA Change: I57V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 31 104 5.79e-9 SMART
IG 112 188 1.44e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to induced arthritis and nephrotoxic nephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Fcgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Fcgr4 APN 1 171025789 missense possibly damaging 0.72
R0193:Fcgr4 UTSW 1 171025760 missense possibly damaging 0.76
R0526:Fcgr4 UTSW 1 171029191 missense probably damaging 0.98
R1164:Fcgr4 UTSW 1 171029170 missense possibly damaging 0.75
R1544:Fcgr4 UTSW 1 171019954 missense probably damaging 1.00
R1716:Fcgr4 UTSW 1 171020103 missense probably damaging 1.00
R1905:Fcgr4 UTSW 1 171029305 missense probably damaging 0.99
R6012:Fcgr4 UTSW 1 171025664 missense possibly damaging 0.80
R6043:Fcgr4 UTSW 1 171020130 missense probably damaging 1.00
R6333:Fcgr4 UTSW 1 171029269 missense probably damaging 0.97
R7034:Fcgr4 UTSW 1 171020088 missense probably benign 0.00
R7036:Fcgr4 UTSW 1 171020088 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTCATAGACCAGCTGAGAGC -3'
(R):5'- GCTTCCTCCAAATAATTCAGGCC -3'

Sequencing Primer
(F):5'- GCCTGTATTACCCTGGGAGTAC -3'
(R):5'- AAATAATTCAGGCCCCTCTTTCC -3'
Posted On2020-06-30