Incidental Mutation 'R8123:Acvr2a'
ID631589
Institutional Source Beutler Lab
Gene Symbol Acvr2a
Ensembl Gene ENSMUSG00000052155
Gene Nameactivin receptor IIA
SynonymsActRIIa, Acvr2, tActRII
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location48814109-48903269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48873372 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000067305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063886]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF THE TYPE II ACTIVIN RECEPTOR [X-RAY DIFFRACTION]
Crystal Structure of the BMP7/ActRII Extracellular Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000063886
AA Change: S143P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067305
Gene: ENSMUSG00000052155
AA Change: S143P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Activin_recp 28 118 5e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Pkinase_Tyr 192 479 1.2e-31 PFAM
Pfam:Pkinase 196 481 7.6e-34 PFAM
low complexity region 486 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: While most mice homozygous for targeted mutations that inactivate this gene appear normal, a few display skeletal and facial abnormalities. As adults, follicle-stimulating hormone is suppressed, affecting reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Acvr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Acvr2a APN 2 48873052 splice site probably benign
IGL01551:Acvr2a APN 2 48897059 missense probably damaging 1.00
IGL01913:Acvr2a APN 2 48899613 missense probably damaging 1.00
IGL02100:Acvr2a APN 2 48898618 splice site probably benign
IGL02210:Acvr2a APN 2 48898526 missense probably damaging 0.99
R0864:Acvr2a UTSW 2 48894786 splice site probably benign
R1371:Acvr2a UTSW 2 48899616 missense probably damaging 1.00
R1676:Acvr2a UTSW 2 48873083 missense probably benign 0.00
R2196:Acvr2a UTSW 2 48870312 missense possibly damaging 0.94
R2876:Acvr2a UTSW 2 48892178 missense probably damaging 1.00
R3721:Acvr2a UTSW 2 48892138 missense probably damaging 1.00
R3763:Acvr2a UTSW 2 48870319 missense possibly damaging 0.87
R4401:Acvr2a UTSW 2 48899702 missense probably benign
R4724:Acvr2a UTSW 2 48870435 missense probably damaging 1.00
R4921:Acvr2a UTSW 2 48893541 missense possibly damaging 0.51
R5060:Acvr2a UTSW 2 48890299 missense probably damaging 0.96
R5347:Acvr2a UTSW 2 48892154 missense probably damaging 1.00
R5953:Acvr2a UTSW 2 48890404 missense probably damaging 1.00
R6892:Acvr2a UTSW 2 48897075 missense probably damaging 1.00
R7594:Acvr2a UTSW 2 48894737 nonsense probably null
R7876:Acvr2a UTSW 2 48870427 missense probably benign 0.01
R8296:Acvr2a UTSW 2 48899724 missense possibly damaging 0.95
Z1088:Acvr2a UTSW 2 48870373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAAGTCACACAGCGTAAG -3'
(R):5'- CTAACAGAGTACTCAGTTATACAGCAG -3'

Sequencing Primer
(F):5'- TCACACAGCGTAAGTGCATAGTG -3'
(R):5'- GTAGGCCATCTTGTGATGT -3'
Posted On2020-06-30