Incidental Mutation 'R8123:Plrg1'
ID631592
Institutional Source Beutler Lab
Gene Symbol Plrg1
Ensembl Gene ENSMUSG00000027998
Gene Namepleiotropic regulator 1
SynonymsTango4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83055522-83072355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83065930 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 181 (A181T)
Ref Sequence ENSEMBL: ENSMUSP00000114968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029628] [ENSMUST00000122128] [ENSMUST00000150268]
Predicted Effect probably benign
Transcript: ENSMUST00000029628
AA Change: A181T

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029628
Gene: ENSMUSG00000027998
AA Change: A181T

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122128
AA Change: A172T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113614
Gene: ENSMUSG00000027998
AA Change: A172T

DomainStartEndE-ValueType
WD40 183 222 1.92e-10 SMART
WD40 225 264 1.68e-6 SMART
WD40 267 306 1.96e-7 SMART
WD40 309 348 5.95e-7 SMART
WD40 351 389 1.12e-2 SMART
WD40 392 430 5.47e-6 SMART
WD40 442 480 5.97e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150268
AA Change: A181T

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114968
Gene: ENSMUSG00000027998
AA Change: A181T

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
WD40 360 398 1.12e-2 SMART
WD40 401 439 5.47e-6 SMART
WD40 451 489 5.97e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Plrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Plrg1 APN 3 83070673 missense probably damaging 0.99
IGL00824:Plrg1 APN 3 83068335 missense probably damaging 1.00
IGL00948:Plrg1 APN 3 83068119 missense probably damaging 1.00
IGL02550:Plrg1 APN 3 83061123 critical splice donor site probably null
R0743:Plrg1 UTSW 3 83059917 missense probably benign 0.11
R1624:Plrg1 UTSW 3 83067994 splice site probably benign
R1624:Plrg1 UTSW 3 83069744 missense probably damaging 1.00
R1630:Plrg1 UTSW 3 83058763 missense probably benign 0.00
R1876:Plrg1 UTSW 3 83069068 splice site probably benign
R2383:Plrg1 UTSW 3 83065948 missense probably damaging 1.00
R2892:Plrg1 UTSW 3 83071240 missense probably damaging 1.00
R3406:Plrg1 UTSW 3 83071219 missense probably damaging 1.00
R5114:Plrg1 UTSW 3 83071251 missense probably benign 0.13
R5922:Plrg1 UTSW 3 83056848 missense possibly damaging 0.77
R6333:Plrg1 UTSW 3 83056795 missense probably damaging 1.00
R7127:Plrg1 UTSW 3 83059915 missense probably damaging 1.00
R7530:Plrg1 UTSW 3 83058682 missense probably damaging 1.00
R7814:Plrg1 UTSW 3 83056837 missense probably damaging 1.00
R8131:Plrg1 UTSW 3 83069774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGTATCTTAGCTGTCTTCCTC -3'
(R):5'- AACAATCAGGCAGGCTCTCC -3'

Sequencing Primer
(F):5'- AGCTGTCTTCCTCTTCAGTTAATG -3'
(R):5'- CGCCACAGTGAAGAACTTTC -3'
Posted On2020-06-30