Incidental Mutation 'R8123:Cc2d2a'
ID 631596
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 067552-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Essential gene? Probably essential (E-score: 0.900) question?
Stock # R8123 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 43662346-43740972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43710554 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 847 (T847S)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably benign
Transcript: ENSMUST00000048150
AA Change: T847S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: T847S

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: T798S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: T798S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43706846 missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43739309 missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43695296 critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43706100 missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43712439 missense probably damaging 1.00
R8179:Cc2d2a UTSW 5 43699953 missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43736145 missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43688228 missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43685144 splice site probably null
R8482:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43735446 missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43739350 missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43703303 missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43699943 missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43710542 missense probably benign
R9122:Cc2d2a UTSW 5 43673739 missense probably null 0.07
R9125:Cc2d2a UTSW 5 43703221 missense probably benign
R9203:Cc2d2a UTSW 5 43733837 missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43695146 missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43718657 missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43703349 critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43703204 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAATCAGAGTCTCCACAGCAAG -3'
(R):5'- GGTGGCAGAGCTGAAATTTC -3'

Sequencing Primer
(F):5'- AGCTTCCTCCTATAGAAGGTCATGG -3'
(R):5'- CTTGCATTCTTAAACAGCTGCACAG -3'
Posted On 2020-06-30