Incidental Mutation 'R8123:Mat2a'
ID631603
Institutional Source Beutler Lab
Gene Symbol Mat2a
Ensembl Gene ENSMUSG00000053907
Gene Namemethionine adenosyltransferase II, alpha
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72432799-72439558 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72434338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205384] [ENSMUST00000205738] [ENSMUST00000205823] [ENSMUST00000206692]
Predicted Effect silent
Transcript: ENSMUST00000059472
SMART Domains Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

DomainStartEndE-ValueType
Pfam:S-AdoMet_synt_N 17 115 1.7e-45 PFAM
Pfam:S-AdoMet_synt_M 129 250 2.4e-47 PFAM
Pfam:S-AdoMet_synt_C 252 389 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065906
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205335
Predicted Effect probably benign
Transcript: ENSMUST00000205384
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably null
Transcript: ENSMUST00000205823
Predicted Effect probably benign
Transcript: ENSMUST00000206692
Predicted Effect probably benign
Transcript: ENSMUST00000206904
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the production of S-adenosylmethionine (AdoMet) from methionine and ATP. AdoMet is the key methyl donor in cellular processes. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Mat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02890:Mat2a APN 6 72436246 missense probably damaging 1.00
R0193:Mat2a UTSW 6 72436195 critical splice donor site probably null
R4022:Mat2a UTSW 6 72436244 missense probably damaging 1.00
R5256:Mat2a UTSW 6 72434333 missense probably benign
R6979:Mat2a UTSW 6 72435113 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAGGGACAGAATAGCAAGCC -3'
(R):5'- TAGCAAACCCCAGGGAGAACTG -3'

Sequencing Primer
(F):5'- GTCATTGATTAGAGTGACTGCAACTG -3'
(R):5'- GGAGAACTGAACTCATTTGCC -3'
Posted On2020-06-30