Incidental Mutation 'R8123:Pou2f2'
ID631605
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene NamePOU domain, class 2, transcription factor 2
SynonymsOct-2, Otf-2, Oct2a, Otf2, Oct2b
MMRRC Submission
Accession Numbers

Genbank: NM_001163554; MGI: 101897

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25087344-25179726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25097008 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 322 (K322R)
Ref Sequence ENSEMBL: ENSMUSP00000104056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000147146] [ENSMUST00000175774] [ENSMUST00000176408]
Predicted Effect probably damaging
Transcript: ENSMUST00000098679
AA Change: K344R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496
AA Change: K344R

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108413
AA Change: K322R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496
AA Change: K322R

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108415
AA Change: K338R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496
AA Change: K338R

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108416
AA Change: K283R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496
AA Change: K283R

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108417
AA Change: K344R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496
AA Change: K344R

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108418
AA Change: K322R

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: K322R

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147146
SMART Domains Protein: ENSMUSP00000118307
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
SCOP:d1gkub1 89 123 2e-3 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175774
AA Change: K322R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496
AA Change: K322R

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176408
AA Change: K338R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496
AA Change: K338R

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 25092700 nonsense probably null
IGL01420:Pou2f2 APN 7 25092952 missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 25097682 missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 25097152 missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 25099946 splice site probably benign
D3080:Pou2f2 UTSW 7 25097133 splice site probably benign
R0347:Pou2f2 UTSW 7 25097701 missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 25116076 nonsense probably null
R0842:Pou2f2 UTSW 7 25096930 missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 25092724 missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 25097288 missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 25097686 nonsense probably null
R4863:Pou2f2 UTSW 7 25097108 intron probably benign
R5362:Pou2f2 UTSW 7 25092895 missense probably benign 0.02
R5995:Pou2f2 UTSW 7 25097444 missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 25093581 missense probably damaging 0.96
R7541:Pou2f2 UTSW 7 25116128 missense probably benign 0.02
R7884:Pou2f2 UTSW 7 25116064 missense probably benign 0.39
RF014:Pou2f2 UTSW 7 25115737 missense unknown
Z1177:Pou2f2 UTSW 7 25093176 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTAGGTACGTTTGCTTCACAC -3'
(R):5'- GACCAGCATCGAGACGAATG -3'

Sequencing Primer
(F):5'- AGGTACGTTTGCTTCACACAGATG -3'
(R):5'- ATCGAGACGAATGTCCGCTTC -3'
Posted On2020-06-30