Incidental Mutation 'R8123:Lamp1'
ID631608
Institutional Source Beutler Lab
Gene Symbol Lamp1
Ensembl Gene ENSMUSG00000031447
Gene Namelysosomal-associated membrane protein 1
SynonymsLamp-1, CD107a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13159161-13175338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13167158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 56 (I56V)
Ref Sequence ENSEMBL: ENSMUSP00000033824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033824] [ENSMUST00000209895]
Predicted Effect probably benign
Transcript: ENSMUST00000033824
AA Change: I56V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033824
Gene: ENSMUSG00000031447
AA Change: I56V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lamp 106 406 4.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209895
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Lamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Lamp1 APN 8 13171195 unclassified probably benign
IGL01516:Lamp1 APN 8 13173863 missense probably damaging 0.98
IGL01541:Lamp1 APN 8 13165905 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0127:Lamp1 UTSW 8 13174491 missense probably damaging 1.00
R0744:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R0836:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R1875:Lamp1 UTSW 8 13167257 missense probably damaging 1.00
R1945:Lamp1 UTSW 8 13172545 missense probably benign 0.40
R2887:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2888:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2889:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2890:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R4235:Lamp1 UTSW 8 13167192 missense possibly damaging 0.66
R4817:Lamp1 UTSW 8 13172541 missense probably benign 0.43
R5654:Lamp1 UTSW 8 13171388 splice site probably null
R5942:Lamp1 UTSW 8 13173941 missense probably damaging 1.00
R6538:Lamp1 UTSW 8 13171285 missense probably benign 0.00
R6917:Lamp1 UTSW 8 13172563 missense probably damaging 1.00
R6977:Lamp1 UTSW 8 13173661 missense probably damaging 0.98
R7262:Lamp1 UTSW 8 13167296 missense probably benign 0.01
R7680:Lamp1 UTSW 8 13167812 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATTGTTTGCATGCATTGAG -3'
(R):5'- ATGGCATTGGGAAAATGTTCTG -3'

Sequencing Primer
(F):5'- GCATGCATTGAGTTATAGTCCAG -3'
(R):5'- GGGAAAATGTTCTGTATCTGACAAG -3'
Posted On2020-06-30