Incidental Mutation 'R8123:Ric8b'
ID631613
Institutional Source Beutler Lab
Gene Symbol Ric8b
Ensembl Gene ENSMUSG00000035620
Gene NameRIC8 guanine nucleotide exchange factor B
SynonymsRic-8b, Ric-8
Accession Numbers

Genbank: NM_001013441, NM_183172; MGI: 2682307

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location84917616-85018337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84969873 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 283 (N283D)
Ref Sequence ENSEMBL: ENSMUSP00000046981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038523] [ENSMUST00000095385] [ENSMUST00000214693]
Predicted Effect probably damaging
Transcript: ENSMUST00000038523
AA Change: N283D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046981
Gene: ENSMUSG00000035620
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Ric8 66 538 8.1e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095385
AA Change: N283D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093032
Gene: ENSMUSG00000035620
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Ric8 66 486 1.2e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214693
AA Change: N80D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(24) : Targeted, other(4) Gene trapped(20)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Ric8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Ric8b APN 10 84980136 missense probably damaging 1.00
IGL02388:Ric8b APN 10 84992271 unclassified probably benign
IGL02435:Ric8b APN 10 84980076 missense probably benign 0.06
IGL02890:Ric8b APN 10 85001867 missense possibly damaging 0.80
IGL03163:Ric8b APN 10 85001822 missense probably damaging 1.00
IGL03211:Ric8b APN 10 85001793 missense probably damaging 1.00
D4216:Ric8b UTSW 10 85015141 missense probably damaging 0.99
R0491:Ric8b UTSW 10 84992222 missense probably damaging 1.00
R0612:Ric8b UTSW 10 85001881 missense probably damaging 1.00
R1077:Ric8b UTSW 10 84970717 splice site probably benign
R1448:Ric8b UTSW 10 84947671 missense possibly damaging 0.93
R1565:Ric8b UTSW 10 84980099 missense probably benign 0.01
R1617:Ric8b UTSW 10 84947611 missense probably damaging 0.98
R1634:Ric8b UTSW 10 84970748 missense probably damaging 1.00
R1983:Ric8b UTSW 10 85001838 missense probably damaging 0.99
R2339:Ric8b UTSW 10 84970024 missense probably benign 0.00
R2897:Ric8b UTSW 10 84947897 missense probably benign 0.01
R2898:Ric8b UTSW 10 84947897 missense probably benign 0.01
R4657:Ric8b UTSW 10 84992137 missense probably damaging 1.00
R4747:Ric8b UTSW 10 84917764 missense probably benign 0.36
R4953:Ric8b UTSW 10 84958082 missense possibly damaging 0.92
R5277:Ric8b UTSW 10 84947652 missense probably damaging 0.99
R5308:Ric8b UTSW 10 84947747 missense probably benign
R5326:Ric8b UTSW 10 84992212 missense probably damaging 1.00
R6248:Ric8b UTSW 10 84947845 missense probably damaging 1.00
R6782:Ric8b UTSW 10 84947527 missense probably damaging 1.00
R7548:Ric8b UTSW 10 84947872 missense probably damaging 1.00
Z1176:Ric8b UTSW 10 84947544 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTGTTTCAGAAGGTGGCG -3'
(R):5'- AATGGCCTCCATATTCATGCC -3'

Sequencing Primer
(F):5'- CAGAAGGTGGCGTGCTGTC -3'
(R):5'- CATGCCATTGTATACCATGGTACTG -3'
Posted On2020-06-30