Incidental Mutation 'R8123:Ngly1'
ID631617
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene NameN-glycanase 1
SynonymsPng1, PNGase, 1110002C09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16249280-16311926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16260799 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 161 (M161K)
Ref Sequence ENSEMBL: ENSMUSP00000152998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000223973] [ENSMUST00000224154] [ENSMUST00000224656]
Predicted Effect probably benign
Transcript: ENSMUST00000022310
AA Change: M161K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: M161K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153109
Predicted Effect probably benign
Transcript: ENSMUST00000223973
AA Change: M60K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224154
Predicted Effect probably benign
Transcript: ENSMUST00000224656
AA Change: M161K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226089
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Dph3 T C 14: 32,083,200 K77R probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16290873 missense probably benign 0.14
IGL02199:Ngly1 APN 14 16290844 missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16281791 missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16290939 intron probably benign
IGL03209:Ngly1 APN 14 16281831 nonsense probably null
IGL03290:Ngly1 APN 14 16281866 missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16260636 missense probably benign
R0518:Ngly1 UTSW 14 16290774 nonsense probably null
R0521:Ngly1 UTSW 14 16290774 nonsense probably null
R1612:Ngly1 UTSW 14 16290867 nonsense probably null
R1851:Ngly1 UTSW 14 16260585 missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16277877 missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16290721 intron probably null
R2696:Ngly1 UTSW 14 16283439 missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16290766 intron probably benign
R3883:Ngly1 UTSW 14 16270574 missense probably damaging 1.00
R4700:Ngly1 UTSW 14 16281809 missense probably benign 0.01
R5160:Ngly1 UTSW 14 16281751 missense probably damaging 0.98
R5555:Ngly1 UTSW 14 16270508 nonsense probably null
R5603:Ngly1 UTSW 14 16260762 missense probably benign 0.01
R5764:Ngly1 UTSW 14 16260799 missense probably benign
R5980:Ngly1 UTSW 14 16270509 missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16294634 missense probably benign 0.01
R6887:Ngly1 UTSW 14 16281836 missense probably benign 0.02
R6943:Ngly1 UTSW 14 16283467 missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16283445 missense probably damaging 1.00
R7447:Ngly1 UTSW 14 16290844 missense probably damaging 1.00
R7748:Ngly1 UTSW 14 16290820 missense possibly damaging 0.62
X0053:Ngly1 UTSW 14 16254743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAACGCATCTTATCTTTCC -3'
(R):5'- AAAGAAGGTGGCCATTTCCCTC -3'

Sequencing Primer
(F):5'- ATCCGTGATCTGATTGCCATAGAGAG -3'
(R):5'- CGCATTTGCTACAACTCTGAC -3'
Posted On2020-06-30