Incidental Mutation 'R8123:Dph3'
ID631618
Institutional Source Beutler Lab
Gene Symbol Dph3
Ensembl Gene ENSMUSG00000021905
Gene Namediphthamine biosynthesis 3
SynonymsDELGIP1, Zcsl2, KTI11, 5730511P15Rik, 2610018L09Rik, DESR1
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8123 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32080566-32085729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32083200 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 77 (K77R)
Ref Sequence ENSEMBL: ENSMUSP00000022461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022461] [ENSMUST00000022462] [ENSMUST00000067955] [ENSMUST00000112001] [ENSMUST00000124303] [ENSMUST00000164868] [ENSMUST00000165523] [ENSMUST00000166810] [ENSMUST00000168986] [ENSMUST00000169649] [ENSMUST00000170600] [ENSMUST00000171598] [ENSMUST00000227845]
PDB Structure
Solution structure of the mouse DESR1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000022461
AA Change: K77R

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022461
Gene: ENSMUSG00000021905
AA Change: K77R

DomainStartEndE-ValueType
Pfam:zf-CSL 6 60 2.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022462
SMART Domains Protein: ENSMUSP00000022462
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
Pfam:NAD_binding_6 168 269 6.5e-9 PFAM
Pfam:NAD_binding_1 173 293 8.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067955
AA Change: K77R

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068491
Gene: ENSMUSG00000021905
AA Change: K77R

DomainStartEndE-ValueType
Pfam:zf-CSL 6 60 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112001
SMART Domains Protein: ENSMUSP00000127944
Gene: ENSMUSG00000021905

DomainStartEndE-ValueType
Pfam:zf-CSL 6 54 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124303
AA Change: K52R

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120583
Gene: ENSMUSG00000021905
AA Change: K52R

DomainStartEndE-ValueType
Pfam:zf-CSL 6 57 2.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164868
SMART Domains Protein: ENSMUSP00000125791
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 149 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165523
Predicted Effect probably benign
Transcript: ENSMUST00000166810
Predicted Effect probably benign
Transcript: ENSMUST00000168986
SMART Domains Protein: ENSMUSP00000126372
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 130 3e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169649
Predicted Effect probably benign
Transcript: ENSMUST00000170600
SMART Domains Protein: ENSMUSP00000130998
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 143 3e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171598
SMART Domains Protein: ENSMUSP00000132162
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 115 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227845
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.0%
  • 20x: 97.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CSL zinc finger-containing protein that is required for dipthamide biosynthesis. The encoded protein is necessary for the initial step in the modification of a histidine residue in elongation factor-2 to diphthamide. This modified residue is a target for ADP ribosylation by the bacterial toxins diphtheria toxin and Pseudomonas exotoxin A. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of chorioallantoic fusion, impaired placental development, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 G T 4: 86,887,035 V79F probably damaging Het
Acvr2a T C 2: 48,873,372 S143P probably damaging Het
Adam22 T A 5: 8,092,833 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ankhd1 T C 18: 36,575,083 F60S Het
Cacna1s A T 1: 136,108,179 I1386F probably damaging Het
Cav2 T A 6: 17,286,993 C145* probably null Het
Cc2d2a A T 5: 43,710,554 T847S probably benign Het
Ces2g T A 8: 104,966,923 M412K probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnajc10 T C 2: 80,349,360 V746A probably damaging Het
Dnm3 A G 1: 162,011,103 S230P probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fcgr4 A G 1: 171,020,003 I57V probably benign Het
Fhad1 A T 4: 141,985,525 I201K probably benign Het
Foxc2 C T 8: 121,116,862 A83V probably damaging Het
Garnl3 T C 2: 33,104,938 K20E probably damaging Het
Gtf2e1 A T 16: 37,515,743 Y290N possibly damaging Het
Gtf3c1 A G 7: 125,704,024 probably benign Het
Itga4 G A 2: 79,315,683 S743N probably benign Het
Lamp1 A G 8: 13,167,158 I56V probably benign Het
Lipt2 A G 7: 100,159,379 D33G probably benign Het
Mat2a A G 6: 72,434,338 probably null Het
Myh2 A G 11: 67,173,309 E65G probably benign Het
Nedd4l T C 18: 65,074,774 L58P probably damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nod1 C T 6: 54,937,406 G801R probably damaging Het
Npy1r A T 8: 66,704,967 I310F probably damaging Het
Olfr113 G C 17: 37,574,762 H220Q probably benign Het
Olfr172 T A 16: 58,761,174 M1L possibly damaging Het
Pde3a A T 6: 141,466,191 Y497F probably benign Het
Pecr A T 1: 72,274,935 S153T probably benign Het
Pi4ka A G 16: 17,281,092 V1976A Het
Plrg1 G A 3: 83,065,930 A181T probably benign Het
Pou2f2 T C 7: 25,097,008 K322R possibly damaging Het
Ppp1r17 T A 6: 56,022,458 D25E probably damaging Het
Radil A C 5: 142,487,620 Y769D probably damaging Het
Ric8b A G 10: 84,969,873 N283D probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Traj39 G A 14: 54,179,994 G11R Het
Ugt2b36 G A 5: 87,092,436 P30L probably damaging Het
Vipr1 C A 9: 121,669,452 P423T probably damaging Het
Vps13a T C 19: 16,647,702 E2731G probably benign Het
Zfp451 A T 1: 33,762,167 M1056K possibly damaging Het
Other mutations in Dph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Dph3 APN 14 32085460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCAGTATGGAATCCAGGG -3'
(R):5'- GCAGCAGTTAGTTCTTGGTACG -3'

Sequencing Primer
(F):5'- GCTGGCATGTCATAGGCTC -3'
(R):5'- TTGTGAGACAAACACCCG -3'
Posted On2020-06-30