Mutagenetix > Incidental Mutation

Incidental Mutation 'R8123:Pi4ka'

631620

Institutional Source

Beutler Lab

Gene Symbol

Pi4ka

Ensembl Gene

ENSMUSG00000041720

Gene Name

phosphatidylinositol 4-kinase alpha

Synonyms

Pik4ca

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8123 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17280351-17406314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17281092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1976 (V1976A)

Ref Sequence

ENSEMBL: ENSMUSP00000036162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: V1976A

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164950

SMART Domains

Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

Domain	Start	End	E-Value	Type
coiled coil region	5	112	N/A	INTRINSIC
Pfam:TMEM191C	182	302	1.5e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000232167

Predicted Effect

probably benign
Transcript: ENSMUST00000232364

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 99.0%
20x: 97.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	G	T	4: 86,887,035	V79F	probably damaging	Het
Acvr2a	T	C	2: 48,873,372	S143P	probably damaging	Het
Adam22	T	A	5: 8,092,833		probably null	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ankhd1	T	C	18: 36,575,083	F60S		Het
Cacna1s	A	T	1: 136,108,179	I1386F	probably damaging	Het
Cav2	T	A	6: 17,286,993	C145*	probably null	Het
Cc2d2a	A	T	5: 43,710,554	T847S	probably benign	Het
Ces2g	T	A	8: 104,966,923	M412K	probably benign	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dnajc10	T	C	2: 80,349,360	V746A	probably damaging	Het
Dnm3	A	G	1: 162,011,103	S230P	probably benign	Het
Dph3	T	C	14: 32,083,200	K77R	probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Fcgr4	A	G	1: 171,020,003	I57V	probably benign	Het
Fhad1	A	T	4: 141,985,525	I201K	probably benign	Het
Foxc2	C	T	8: 121,116,862	A83V	probably damaging	Het
Garnl3	T	C	2: 33,104,938	K20E	probably damaging	Het
Gtf2e1	A	T	16: 37,515,743	Y290N	possibly damaging	Het
Gtf3c1	A	G	7: 125,704,024		probably benign	Het
Itga4	G	A	2: 79,315,683	S743N	probably benign	Het
Lamp1	A	G	8: 13,167,158	I56V	probably benign	Het
Lipt2	A	G	7: 100,159,379	D33G	probably benign	Het
Mat2a	A	G	6: 72,434,338		probably null	Het
Myh2	A	G	11: 67,173,309	E65G	probably benign	Het
Nedd4l	T	C	18: 65,074,774	L58P	probably damaging	Het
Ngly1	T	A	14: 16,260,799	M161K	probably benign	Het
Nod1	C	T	6: 54,937,406	G801R	probably damaging	Het
Npy1r	A	T	8: 66,704,967	I310F	probably damaging	Het
Olfr113	G	C	17: 37,574,762	H220Q	probably benign	Het
Olfr172	T	A	16: 58,761,174	M1L	possibly damaging	Het
Pde3a	A	T	6: 141,466,191	Y497F	probably benign	Het
Pecr	A	T	1: 72,274,935	S153T	probably benign	Het
Plrg1	G	A	3: 83,065,930	A181T	probably benign	Het
Pou2f2	T	C	7: 25,097,008	K322R	possibly damaging	Het
Ppp1r17	T	A	6: 56,022,458	D25E	probably damaging	Het
Radil	A	C	5: 142,487,620	Y769D	probably damaging	Het
Ric8b	A	G	10: 84,969,873	N283D	probably damaging	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Traj39	G	A	14: 54,179,994	G11R		Het
Ugt2b36	G	A	5: 87,092,436	P30L	probably damaging	Het
Vipr1	C	A	9: 121,669,452	P423T	probably damaging	Het
Vps13a	T	C	19: 16,647,702	E2731G	probably benign	Het
Zfp451	A	T	1: 33,762,167	M1056K	possibly damaging	Het

Other mutations in Pi4ka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Pi4ka	APN	16	17308144	missense	probably benign
IGL00984:Pi4ka	APN	16	17358932	nonsense	probably null
IGL01066:Pi4ka	APN	16	17348773	splice site	probably benign
IGL01460:Pi4ka	APN	16	17357651	missense	probably damaging	1.00
IGL01505:Pi4ka	APN	16	17309358	missense	probably benign	0.22
IGL01518:Pi4ka	APN	16	17280735	missense	probably benign	0.03
IGL01533:Pi4ka	APN	16	17308201	missense	probably benign	0.30
IGL01565:Pi4ka	APN	16	17389442	utr 5 prime	probably benign
IGL01679:Pi4ka	APN	16	17296888	splice site	probably benign
IGL01685:Pi4ka	APN	16	17325202	missense	probably benign	0.09
IGL01734:Pi4ka	APN	16	17297260	missense	probably benign	0.23
IGL01799:Pi4ka	APN	16	17389371	missense	probably damaging	1.00
IGL01969:Pi4ka	APN	16	17378483	missense	probably benign	0.15
IGL02092:Pi4ka	APN	16	17318496	missense	probably benign	0.00
IGL02113:Pi4ka	APN	16	17373415	missense	probably benign	0.00
IGL02177:Pi4ka	APN	16	17318282	missense	probably benign	0.09
IGL02400:Pi4ka	APN	16	17293884	missense	probably damaging	0.98
IGL02426:Pi4ka	APN	16	17378432	splice site	probably benign
IGL02474:Pi4ka	APN	16	17325429	missense	probably damaging	1.00
IGL02587:Pi4ka	APN	16	17317353	missense	probably damaging	1.00
IGL02667:Pi4ka	APN	16	17295461	missense	possibly damaging	0.82
IGL02698:Pi4ka	APN	16	17291168	missense	probably damaging	1.00
IGL02815:Pi4ka	APN	16	17358889	splice site	probably benign
IGL02828:Pi4ka	APN	16	17280711	intron	probably benign
IGL02939:Pi4ka	APN	16	17354210	missense	probably damaging	0.97
IGL03123:Pi4ka	APN	16	17282675	missense	possibly damaging	0.95
IGL03148:Pi4ka	APN	16	17354189	missense	probably damaging	0.99
arachnoid	UTSW	16	17285281	unclassified	probably benign
dove_bar	UTSW	16	17326052	splice site	probably null
mia	UTSW	16	17376982	missense	possibly damaging	0.89
Pia	UTSW	16	17281044	missense	probably damaging	1.00
G1patch:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
IGL03098:Pi4ka	UTSW	16	17326027	missense	probably damaging	1.00
R0024:Pi4ka	UTSW	16	17315535	splice site	probably benign
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0243:Pi4ka	UTSW	16	17297635	missense	probably benign	0.44
R0374:Pi4ka	UTSW	16	17282932	unclassified	probably benign
R0478:Pi4ka	UTSW	16	17309311	missense	possibly damaging	0.92
R0548:Pi4ka	UTSW	16	17307718	missense	possibly damaging	0.75
R0626:Pi4ka	UTSW	16	17293901	missense	probably benign	0.00
R0918:Pi4ka	UTSW	16	17285260	missense	possibly damaging	0.61
R1082:Pi4ka	UTSW	16	17389352	missense	probably damaging	1.00
R1384:Pi4ka	UTSW	16	17297537	splice site	probably benign
R1455:Pi4ka	UTSW	16	17363954	missense	probably benign	0.02
R1479:Pi4ka	UTSW	16	17373400	missense	probably benign	0.08
R1490:Pi4ka	UTSW	16	17386268	missense	probably damaging	1.00
R1565:Pi4ka	UTSW	16	17281900	missense	probably null
R1594:Pi4ka	UTSW	16	17373419	splice site	probably benign
R1641:Pi4ka	UTSW	16	17377030	missense	probably benign	0.00
R1694:Pi4ka	UTSW	16	17295376	missense	probably damaging	0.99
R1828:Pi4ka	UTSW	16	17280750	missense	probably benign	0.00
R1864:Pi4ka	UTSW	16	17367525	nonsense	probably null
R2036:Pi4ka	UTSW	16	17303112	missense	probably damaging	1.00
R2151:Pi4ka	UTSW	16	17367507	missense	probably benign	0.44
R2844:Pi4ka	UTSW	16	17350793	missense	probably damaging	0.97
R2876:Pi4ka	UTSW	16	17367550	missense	possibly damaging	0.77
R3953:Pi4ka	UTSW	16	17285281	unclassified	probably benign
R3972:Pi4ka	UTSW	16	17293875	missense	probably damaging	1.00
R4357:Pi4ka	UTSW	16	17367439	missense	probably benign	0.00
R4385:Pi4ka	UTSW	16	17386265	missense	probably benign	0.13
R4427:Pi4ka	UTSW	16	17281044	missense	probably damaging	1.00
R4436:Pi4ka	UTSW	16	17282382	missense	probably damaging	1.00
R4677:Pi4ka	UTSW	16	17282373	missense	probably damaging	1.00
R4683:Pi4ka	UTSW	16	17297037	missense	possibly damaging	0.73
R4736:Pi4ka	UTSW	16	17377175	missense	probably benign	0.12
R4804:Pi4ka	UTSW	16	17308161	missense	possibly damaging	0.75
R4886:Pi4ka	UTSW	16	17358361	missense
R4893:Pi4ka	UTSW	16	17377036	missense	probably benign	0.21
R4896:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5004:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5015:Pi4ka	UTSW	16	17303082	missense	possibly damaging	0.56
R5062:Pi4ka	UTSW	16	17309397	missense	probably benign	0.02
R5104:Pi4ka	UTSW	16	17281050	missense	probably damaging	1.00
R5160:Pi4ka	UTSW	16	17323053	missense	probably benign	0.01
R5173:Pi4ka	UTSW	16	17350906	missense	possibly damaging	0.95
R5204:Pi4ka	UTSW	16	17359045	missense	possibly damaging	0.68
R5307:Pi4ka	UTSW	16	17323030	missense	probably benign	0.00
R5327:Pi4ka	UTSW	16	17325413	missense	probably damaging	1.00
R5506:Pi4ka	UTSW	16	17293953	missense	probably damaging	0.96
R5580:Pi4ka	UTSW	16	17281087	missense	probably damaging	1.00
R5768:Pi4ka	UTSW	16	17354872	missense	probably benign	0.29
R5857:Pi4ka	UTSW	16	17358984	missense	probably benign	0.00
R5951:Pi4ka	UTSW	16	17303142	missense	probably damaging	1.00
R5953:Pi4ka	UTSW	16	17281951	missense
R6041:Pi4ka	UTSW	16	17360572	missense	probably benign
R6223:Pi4ka	UTSW	16	17357571	nonsense	probably null
R6416:Pi4ka	UTSW	16	17358322	missense	probably benign	0.22
R6535:Pi4ka	UTSW	16	17301036	missense	probably damaging	1.00
R6580:Pi4ka	UTSW	16	17350830	missense	probably damaging	1.00
R6720:Pi4ka	UTSW	16	17326052	splice site	probably null
R6723:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6725:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6752:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6753:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6755:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6767:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6768:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6782:Pi4ka	UTSW	16	17325988	missense	probably damaging	1.00
R6782:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6788:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6849:Pi4ka	UTSW	16	17303421	missense	possibly damaging	0.54
R6958:Pi4ka	UTSW	16	17325227	missense	probably damaging	1.00
R7014:Pi4ka	UTSW	16	17297067	unclassified	probably benign
R7055:Pi4ka	UTSW	16	17317015	utr 3 prime	probably benign
R7317:Pi4ka	UTSW	16	17405632	critical splice donor site	probably null
R7533:Pi4ka	UTSW	16	17297661	missense
R7552:Pi4ka	UTSW	16	17291216	missense
R7581:Pi4ka	UTSW	16	17301060	missense
R7622:Pi4ka	UTSW	16	17293977	missense
R7717:Pi4ka	UTSW	16	17376923	missense
R8048:Pi4ka	UTSW	16	17303127	missense
R8052:Pi4ka	UTSW	16	17356166	missense
R8079:Pi4ka	UTSW	16	17303060	missense
R8211:Pi4ka	UTSW	16	17282905	missense
R8310:Pi4ka	UTSW	16	17354048	critical splice donor site	probably null
R8322:Pi4ka	UTSW	16	17357573	missense
R8509:Pi4ka	UTSW	16	17354144	missense
R8735:Pi4ka	UTSW	16	17318370	missense
R8912:Pi4ka	UTSW	16	17389366	missense
R8917:Pi4ka	UTSW	16	17312446	missense
R8921:Pi4ka	UTSW	16	17307740	missense
R8941:Pi4ka	UTSW	16	17296943	unclassified	probably benign
R9002:Pi4ka	UTSW	16	17299453	missense
R9203:Pi4ka	UTSW	16	17282301	missense
R9222:Pi4ka	UTSW	16	17358361	missense
R9230:Pi4ka	UTSW	16	17281924	missense
R9262:Pi4ka	UTSW	16	17302995	missense
R9338:Pi4ka	UTSW	16	17317363	missense
R9374:Pi4ka	UTSW	16	17307710	missense
R9436:Pi4ka	UTSW	16	17307806	missense
R9499:Pi4ka	UTSW	16	17307710	missense
R9501:Pi4ka	UTSW	16	17386292	missense
R9551:Pi4ka	UTSW	16	17307710	missense
R9705:Pi4ka	UTSW	16	17281951	missense
RF007:Pi4ka	UTSW	16	17297233	missense
U24488:Pi4ka	UTSW	16	17325176	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGTCTAGTATGCTCCCTGATCC -3'
(R):5'- GCATCTTTGAAACCCCTGCTG -3'

Sequencing Primer
(F):5'- TGATCCTCGCCAGCAATTACTAGG -3'
(R):5'- TTTGAAACCCCTGCTGGAAGC -3'

Posted On

2020-06-30