Incidental Mutation 'R8124:Tmem87a'
ID631633
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Nametransmembrane protein 87A
SynonymsA930025J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120355312-120404113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120392195 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 168 (T168A)
Ref Sequence ENSEMBL: ENSMUSP00000087500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729]
Predicted Effect probably benign
Transcript: ENSMUST00000090042
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808
AA Change: T168A

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090046
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808
AA Change: T168A

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110729
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808
AA Change: T168A

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
ANU18:Tmem87a UTSW 2 120380769 missense probably benign 0.01
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2396:Tmem87a UTSW 2 120404059 start codon destroyed probably null 0.02
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5642:Tmem87a UTSW 2 120403946 missense probably benign 0.00
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6158:Tmem87a UTSW 2 120360103 splice site probably null
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6261:Tmem87a UTSW 2 120404021 missense possibly damaging 0.57
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCTCCACACAACTGTATTG -3'
(R):5'- CTTTTCTGGGGATTTTACACATCG -3'

Sequencing Primer
(F):5'- AAGGATTCCCAAGGTAATATGGG -3'
(R):5'- GGGGATTTTACACATCGACTTC -3'
Posted On2020-06-30