Mutagenetix > Incidental Mutations

Incidental Mutation 'R8124:Zfp106'

631634

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8124 (G1)

Quality Score

188.009

Status

Validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 120524331 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1343 (Q1343K)

Ref Sequence

ENSEMBL: ENSMUSP00000055602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000152347] [ENSMUST00000171215]

Predicted Effect

probably benign
Transcript: ENSMUST00000055241
AA Change: Q1343K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: Q1343K

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152347
AA Change: Q97K

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132902
Gene: ENSMUSG00000027288
AA Change: Q97K

Domain	Start	End	E-Value	Type
low complexity region	66	75	N/A	INTRINSIC
low complexity region	115	127	N/A	INTRINSIC
low complexity region	143	163	N/A	INTRINSIC
Pfam:WD40	234	265	1.3e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably benign
Transcript: ENSMUST00000171215
AA Change: Q1320K

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: Q1320K

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap3	T	A	5: 24,478,130	I320N	probably benign	Het
Ahnak	G	A	19: 9,007,123	G1924S	probably damaging	Het
Ap2a2	G	A	7: 141,598,844	R141H	probably benign	Het
Atf7ip2	T	C	16: 10,209,135	V89A	possibly damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Csnk2a2	G	A	8: 95,455,947	P296L		Het
Dab2	T	A	15: 6,429,397	C263*	probably null	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Ddx60	C	T	8: 61,983,911	A965V	probably benign	Het
Dennd5a	A	T	7: 109,897,935	I1119N	probably damaging	Het
Dpy30	A	G	17: 74,316,104		probably benign	Het
Epg5	G	A	18: 77,964,996	A780T	probably benign	Het
Etl4	A	G	2: 20,806,640	D1546G	probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
F13a1	T	C	13: 37,025,805	K62R	probably damaging	Het
Gm2832	T	C	14: 41,278,937	M44T		Het
Gm884	A	G	11: 103,620,431	V237A	unknown	Het
Gm9195	T	C	14: 72,442,623	I2249V	probably benign	Het
Hmcn2	T	C	2: 31,400,124	V2323A	probably benign	Het
Ice2	T	A	9: 69,400,495	N20K	probably damaging	Het
Klf15	T	C	6: 90,466,881	F146S	probably damaging	Het
Lgi3	A	G	14: 70,534,738	Y241C	probably damaging	Het
Lig4	A	T	8: 9,972,954	D275E	probably damaging	Het
Lrit1	T	A	14: 37,062,048	S444R	probably benign	Het
Mip	T	C	10: 128,226,201	V107A	possibly damaging	Het
Myo15	G	A	11: 60,507,453	V1581M		Het
Nckap1l	A	G	15: 103,473,821	D481G	possibly damaging	Het
Obox3	A	T	7: 15,589,949		probably null	Het
Olfr1438-ps1	T	A	19: 12,333,470	N129Y	probably damaging	Het
Olfr491	C	A	7: 108,317,777	N294K	possibly damaging	Het
Olfr707	G	A	7: 106,891,881	T76I	possibly damaging	Het
Olfr749	C	T	14: 50,736,286	R292H	probably benign	Het
Olfr944	T	C	9: 39,217,671	F105L	probably benign	Het
Papd7	G	A	13: 69,533,597		probably benign	Het
Pilrb2	T	A	5: 137,871,044	E98V	probably damaging	Het
Plekhm1	A	G	11: 103,366,949	V1053A	probably benign	Het
Prdm2	A	T	4: 143,135,265	V485E	probably damaging	Het
Riox2	G	A	16: 59,486,591	E282K	probably benign	Het
Rps6ka2	T	A	17: 7,281,829	V379E	possibly damaging	Het
Skiv2l2	A	C	13: 112,927,337	D7E	probably benign	Het
Slc4a7	G	A	14: 14,729,211	E20K	possibly damaging	Het
Sned1	G	A	1: 93,282,989		probably null	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tmem132d	T	C	5: 127,792,560	Q570R	probably damaging	Het
Tmem87a	T	C	2: 120,392,195	T168A	probably benign	Het
Trank1	A	G	9: 111,378,927	R1747G	probably benign	Het
Txk	C	T	5: 72,703,263		probably null	Het
Vcan	T	A	13: 89,704,254	L862F	possibly damaging	Het
Wdr64	A	T	1: 175,799,278		probably null	Het
Zfp719	A	G	7: 43,589,890	T301A	probably benign	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0558:Zfp106	UTSW	2	120532196	missense	probably damaging	1.00
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1754:Zfp106	UTSW	2	120533764	missense	probably damaging	0.98
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3720:Zfp106	UTSW	2	120534599	missense	probably benign	0.01
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5227:Zfp106	UTSW	2	120523968	missense	probably benign	0.11
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7897:Zfp106	UTSW	2	120535615	nonsense	probably null
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTTGACCTTCCTTGCAGG -3'
(R):5'- AGTCAACAGAGAACTGCCAG -3'

Sequencing Primer
(F):5'- GCTTAGCCGTGAACACATCCTG -3'
(R):5'- TTCTGTGGAGCAAGGAAATTCC -3'

Posted On

2020-06-30