Incidental Mutation 'R8124:Prdm2'
ID631635
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8124 (G1)
Quality Score222.009
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143135265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 485 (V485E)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: V485E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: V485E

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACACATCATCTGCGTCCC -3'
(R):5'- CAGCATGGCATTACAATCCTCAG -3'

Sequencing Primer
(F):5'- ATCATCTGCGTCCCCGTCC -3'
(R):5'- TCCTCAGAGGACCCAGACGATG -3'
Posted On2020-06-30