Incidental Mutation 'R8124:Agap3'
ID631636
Institutional Source Beutler Lab
Gene Symbol Agap3
Ensembl Gene ENSMUSG00000023353
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 3
SynonymsCrag, Centg3, MRIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R8124 (G1)
Quality Score202.009
Status Validated
Chromosome5
Chromosomal Location24452177-24502047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24478130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 320 (I320N)
Ref Sequence ENSEMBL: ENSMUSP00000024123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024123] [ENSMUST00000199856] [ENSMUST00000212381]
Predicted Effect probably benign
Transcript: ENSMUST00000024123
AA Change: I320N

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000024123
Gene: ENSMUSG00000023353
AA Change: I320N

DomainStartEndE-ValueType
low complexity region 4 59 N/A INTRINSIC
Pfam:Ras 128 286 1.2e-18 PFAM
low complexity region 328 345 N/A INTRINSIC
PH 403 642 2.76e-16 SMART
ArfGap 661 781 9.17e-51 SMART
ANK 820 849 2.43e1 SMART
ANK 853 885 9.17e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197513
Predicted Effect probably damaging
Transcript: ENSMUST00000199856
AA Change: I503N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142529
Gene: ENSMUSG00000023353
AA Change: I503N

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
low complexity region 66 108 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
small_GTPase 307 473 3.2e-11 SMART
low complexity region 511 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212381
AA Change: I320N

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Agap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Agap3 APN 5 24498109 missense probably damaging 0.99
IGL00900:Agap3 APN 5 24476368 splice site probably benign
IGL00966:Agap3 APN 5 24501002 splice site probably benign
IGL02207:Agap3 APN 5 24499936 missense probably benign
IGL02431:Agap3 APN 5 24501012 missense probably damaging 1.00
IGL02601:Agap3 APN 5 24483371 missense possibly damaging 0.67
IGL03090:Agap3 APN 5 24501206 missense possibly damaging 0.91
IGL03131:Agap3 APN 5 24477132 missense probably benign 0.16
IGL03247:Agap3 APN 5 24487822 missense probably damaging 1.00
R0165:Agap3 UTSW 5 24479745 missense probably damaging 0.98
R0344:Agap3 UTSW 5 24451202 unclassified probably benign
R0496:Agap3 UTSW 5 24501243 missense probably damaging 1.00
R0542:Agap3 UTSW 5 24500186 missense possibly damaging 0.95
R1427:Agap3 UTSW 5 24476693 missense probably benign 0.03
R1840:Agap3 UTSW 5 24500231 missense probably damaging 1.00
R1903:Agap3 UTSW 5 24493013 missense probably damaging 1.00
R2101:Agap3 UTSW 5 24487799 missense probably damaging 1.00
R4601:Agap3 UTSW 5 24476408 missense probably damaging 1.00
R4745:Agap3 UTSW 5 24451125 splice site probably null
R4807:Agap3 UTSW 5 24477116 missense probably damaging 1.00
R4808:Agap3 UTSW 5 24501245 missense probably benign
R4916:Agap3 UTSW 5 24478013 missense probably damaging 0.98
R5056:Agap3 UTSW 5 24477862 missense probably damaging 1.00
R5094:Agap3 UTSW 5 24451321 unclassified probably benign
R5646:Agap3 UTSW 5 24483397 missense probably benign 0.01
R5937:Agap3 UTSW 5 24477817 missense probably damaging 0.99
R6365:Agap3 UTSW 5 24474985 missense probably benign 0.43
R6798:Agap3 UTSW 5 24498282 splice site probably null
R6802:Agap3 UTSW 5 24487793 missense possibly damaging 0.87
R6863:Agap3 UTSW 5 24452463 missense possibly damaging 0.63
R6863:Agap3 UTSW 5 24452464 nonsense probably null
R7039:Agap3 UTSW 5 24483401 missense probably benign 0.01
R7111:Agap3 UTSW 5 24501398 missense probably damaging 1.00
R7313:Agap3 UTSW 5 24452384 missense probably benign 0.25
R7791:Agap3 UTSW 5 24476413 missense probably damaging 1.00
R8293:Agap3 UTSW 5 24487885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTTGGGGAGCTGCCAACC -3'
(R):5'- GAGTTCACAAGAGCACGTGC -3'

Sequencing Primer
(F):5'- GAGCTGCCAACCTGGATTTTGAAC -3'
(R):5'- TCGTGACGAGGGAAGACAGTG -3'
Posted On2020-06-30