Incidental Mutation 'R8124:Dao'
ID631637
Institutional Source Beutler Lab
Gene Symbol Dao
Ensembl Gene ENSMUSG00000042096
Gene NameD-amino acid oxidase
SynonymsDao-1, DAO, Dao1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8124 (G1)
Quality Score207.468
Status Validated
Chromosome5
Chromosomal Location114003703-114025682 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AGG to AG at 114015209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086599] [ENSMUST00000112292] [ENSMUST00000161610]
Predicted Effect probably benign
Transcript: ENSMUST00000086599
SMART Domains Protein: ENSMUSP00000083792
Gene: ENSMUSG00000042096

DomainStartEndE-ValueType
Pfam:DAO 2 245 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112292
SMART Domains Protein: ENSMUSP00000107911
Gene: ENSMUSG00000042096

DomainStartEndE-ValueType
Pfam:DAO 2 327 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161610
SMART Domains Protein: ENSMUSP00000125588
Gene: ENSMUSG00000042096

DomainStartEndE-ValueType
Pfam:DAO 2 327 4.5e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199175
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased levels of D-serine and a decrease in the severity of behavioral effects induced by NMDA receptor antagonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Dao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Dao APN 5 114023820 splice site probably benign
IGL02499:Dao APN 5 114013941 missense possibly damaging 0.77
IGL03063:Dao APN 5 114021015 missense probably damaging 1.00
IGL03054:Dao UTSW 5 114024902 missense probably damaging 1.00
R0127:Dao UTSW 5 114019963 missense probably damaging 1.00
R4461:Dao UTSW 5 114019926 missense probably damaging 1.00
R4747:Dao UTSW 5 114012632 missense probably benign 0.12
R5176:Dao UTSW 5 114020009 critical splice donor site probably null
R5226:Dao UTSW 5 114021033 missense probably benign 0.00
R7388:Dao UTSW 5 114015212 makesense probably null
R7968:Dao UTSW 5 114015209 critical splice donor site probably benign
R7969:Dao UTSW 5 114015209 critical splice donor site probably benign
R7970:Dao UTSW 5 114015209 critical splice donor site probably benign
R7971:Dao UTSW 5 114015209 critical splice donor site probably benign
R7972:Dao UTSW 5 114015209 critical splice donor site probably benign
R7973:Dao UTSW 5 114015209 critical splice donor site probably benign
R8018:Dao UTSW 5 114015209 critical splice donor site probably benign
R8020:Dao UTSW 5 114015209 critical splice donor site probably benign
R8045:Dao UTSW 5 114015209 critical splice donor site probably benign
R8123:Dao UTSW 5 114015209 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTGCAAAGAGCTAACCCTC -3'
(R):5'- GTTGATGCTCTGCAGGATGC -3'

Sequencing Primer
(F):5'- AATGCTACCTAGTGGCTCAGC -3'
(R):5'- TGCAGAACCATGGCTTCAG -3'
Posted On2020-06-30