Incidental Mutation 'R8124:Tmem132d'
ID631638
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Nametransmembrane protein 132D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8124 (G1)
Quality Score171.009
Status Validated
Chromosome5
Chromosomal Location127781630-128433077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127792560 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 570 (Q570R)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
Predicted Effect probably damaging
Transcript: ENSMUST00000044441
AA Change: Q570R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: Q570R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127784832 missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127784638 missense probably benign 0.31
IGL01482:Tmem132d APN 5 128269206 missense probably damaging 0.96
IGL01785:Tmem132d APN 5 127984315 missense probably benign 0.00
IGL02409:Tmem132d APN 5 127784888 missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127783979 missense probably benign 0.01
IGL03411:Tmem132d APN 5 127984283 nonsense probably null
R0113:Tmem132d UTSW 5 127784593 missense probably benign 0.11
R0420:Tmem132d UTSW 5 127864646 missense probably benign 0.26
R0437:Tmem132d UTSW 5 127789785 missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128269203 missense probably damaging 1.00
R0564:Tmem132d UTSW 5 127784778 missense probably damaging 1.00
R0659:Tmem132d UTSW 5 127984287 missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 127984439 splice site probably benign
R1209:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127784859 missense probably benign
R1378:Tmem132d UTSW 5 128268947 missense probably benign 0.43
R1741:Tmem132d UTSW 5 127784858 missense probably benign 0.30
R1753:Tmem132d UTSW 5 127789855 missense probably benign 0.02
R1944:Tmem132d UTSW 5 127783764 makesense probably null
R1974:Tmem132d UTSW 5 128269199 missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127792458 missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127784441 missense probably benign
R2074:Tmem132d UTSW 5 128269131 missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127795923 missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128268544 missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127864599 missense probably benign 0.09
R2902:Tmem132d UTSW 5 127783768 missense probably benign
R3053:Tmem132d UTSW 5 127792474 missense probably benign 0.15
R3836:Tmem132d UTSW 5 127784885 missense probably damaging 1.00
R4127:Tmem132d UTSW 5 128268820 missense probably benign 0.35
R4236:Tmem132d UTSW 5 128432325 missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 127984341 missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 127984296 missense probably benign 0.29
R4686:Tmem132d UTSW 5 127792610 missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 127984264 missense probably benign 0.01
R4883:Tmem132d UTSW 5 128269300 missense probably damaging 0.99
R4883:Tmem132d UTSW 5 128269302 missense possibly damaging 0.79
R4939:Tmem132d UTSW 5 127796075 missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127796000 missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127784795 missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127784900 missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128269272 missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127784598 missense probably benign 0.13
R6048:Tmem132d UTSW 5 128269117 missense probably benign 0.03
R6057:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R6084:Tmem132d UTSW 5 127784100 missense probably benign 0.06
R6505:Tmem132d UTSW 5 127784438 missense probably benign 0.00
R6522:Tmem132d UTSW 5 127783768 missense probably benign
R6540:Tmem132d UTSW 5 128268532 missense possibly damaging 0.87
R6717:Tmem132d UTSW 5 127784421 missense probably benign
R7158:Tmem132d UTSW 5 128137019 missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 127984351 missense probably damaging 0.96
R7526:Tmem132d UTSW 5 127784141 nonsense probably null
R7826:Tmem132d UTSW 5 127789889 missense probably damaging 1.00
R7864:Tmem132d UTSW 5 127783916 missense probably damaging 1.00
R8543:Tmem132d UTSW 5 128268735 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATAGTGGTCATGCCCAGCTC -3'
(R):5'- TGTCACACTGGTGGTTTAGC -3'

Sequencing Primer
(F):5'- TGGCCAGTCAGGATCTGC -3'
(R):5'- ACTGGTGGTTTAGCACCCTGAATC -3'
Posted On2020-06-30