Incidental Mutation 'R8124:Zfp719'
ID631641
Institutional Source Beutler Lab
Gene Symbol Zfp719
Ensembl Gene ENSMUSG00000030469
Gene Namezinc finger protein 719
Synonyms9430094P17Rik, mszf6, C630016O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43579610-43593235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43589890 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 301 (T301A)
Ref Sequence ENSEMBL: ENSMUSP00000050968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058104] [ENSMUST00000205769]
Predicted Effect probably benign
Transcript: ENSMUST00000058104
AA Change: T301A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050968
Gene: ENSMUSG00000030469
AA Change: T301A

DomainStartEndE-ValueType
KRAB 49 109 1.18e-20 SMART
ZnF_C2H2 285 305 4.16e1 SMART
ZnF_C2H2 341 363 1.2e-3 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
ZnF_C2H2 397 419 6.67e-2 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 3.34e-2 SMART
ZnF_C2H2 481 503 1.38e-3 SMART
ZnF_C2H2 509 531 5.42e-2 SMART
ZnF_C2H2 537 559 3.78e-1 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 4.54e-4 SMART
ZnF_C2H2 621 643 4.24e-4 SMART
ZnF_C2H2 649 671 6.42e-4 SMART
ZnF_C2H2 677 699 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205769
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Other mutations in Zfp719
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Zfp719 APN 7 43591130 missense probably damaging 1.00
IGL01407:Zfp719 APN 7 43584187 missense probably benign 0.00
IGL01763:Zfp719 APN 7 43584189 missense probably benign 0.00
IGL03079:Zfp719 APN 7 43591166 missense probably damaging 1.00
R0522:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0524:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0542:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0543:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0662:Zfp719 UTSW 7 43584254 missense possibly damaging 0.56
R1390:Zfp719 UTSW 7 43590443 missense possibly damaging 0.69
R2959:Zfp719 UTSW 7 43590427 missense possibly damaging 0.89
R4708:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4709:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4710:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4716:Zfp719 UTSW 7 43591111 missense possibly damaging 0.80
R4729:Zfp719 UTSW 7 43590410 missense probably damaging 1.00
R4755:Zfp719 UTSW 7 43590793 missense probably damaging 1.00
R5176:Zfp719 UTSW 7 43591125 missense probably damaging 1.00
R5949:Zfp719 UTSW 7 43584117 intron probably benign
R6063:Zfp719 UTSW 7 43589626 nonsense probably null
R6363:Zfp719 UTSW 7 43589866 missense probably benign 0.03
R6434:Zfp719 UTSW 7 43590988 missense probably damaging 1.00
R6465:Zfp719 UTSW 7 43590684 nonsense probably null
R6806:Zfp719 UTSW 7 43586385 missense possibly damaging 0.63
R6925:Zfp719 UTSW 7 43590706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAGAGTCAGTTTGGAAAC -3'
(R):5'- TCCTGAATGATTCTCCACAGTGAAAG -3'

Sequencing Primer
(F):5'- AAACATTGTTTCTCTTAATCCACCAC -3'
(R):5'- ACAGTCACTGCATGTGTACG -3'
Posted On2020-06-30