Incidental Mutation 'R8124:Dennd5a'
ID631644
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109897935 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1119 (I1119N)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080437
AA Change: I1119N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: I1119N

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: I1095N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: I1095N

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 splice site probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109901159 missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109896967 missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109921507 missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109933989 missense probably benign
R7873:Dennd5a UTSW 7 109926934 missense probably damaging 1.00
R8309:Dennd5a UTSW 7 109901125 missense probably damaging 1.00
R8345:Dennd5a UTSW 7 109905270 missense possibly damaging 0.55
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Z1177:Dennd5a UTSW 7 109934024 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATATGCTGTTCTGGACTC -3'
(R):5'- GCGAGAGTCTCTGCTTTCTGAG -3'

Sequencing Primer
(F):5'- GGGGAATATGCGCCTATAATCCC -3'
(R):5'- GAGAGTCTCTGCTTTCTGAGATCTC -3'
Posted On2020-06-30