Incidental Mutation 'R8124:Ap2a2'
ID631645
Institutional Source Beutler Lab
Gene Symbol Ap2a2
Ensembl Gene ENSMUSG00000002957
Gene Nameadaptor-related protein complex 2, alpha 2 subunit
Synonymsalpha-C adaptin, alpha-adaptin C, 2410074K14Rik, Adtab, L25
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141562173-141633011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141598844 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 141 (R141H)
Ref Sequence ENSEMBL: ENSMUSP00000003038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000201261]
PDB Structure
ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM CLATHRIN ADAPTOR AP2 [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH AMPHIPHYSIN FXDXF [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM THE AP2 ADAPTOR COMPLEX, BOUND TO 2 PEPTIDES FROM SYNAPTOJANIN170 [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE with Dileucine peptide RM(phosphoS)QIKRLLSE [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000003038
AA Change: R141H

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201261
AA Change: R128H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144090
Gene: ENSMUSG00000002957
AA Change: R128H

DomainStartEndE-ValueType
Pfam:Adaptin_N 16 131 9.9e-33 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP-2 adaptor protein complex, which is involved in linking lipid and protein membrane components with the clathrin lattice. This interaction supports the formation of clathrin-coated vesicles, and the encoded subunit aids in the process by binding polyphosphoinositide-containing lipids in the cell membrane. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Ap2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ap2a2 APN 7 141605019 splice site probably benign
IGL02664:Ap2a2 APN 7 141629223 missense probably benign 0.00
IGL02973:Ap2a2 APN 7 141631364 missense possibly damaging 0.63
IGL03366:Ap2a2 APN 7 141629273 missense probably benign
R0345:Ap2a2 UTSW 7 141631293 missense probably damaging 1.00
R2212:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R2904:Ap2a2 UTSW 7 141619478 missense probably damaging 0.98
R3412:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R3413:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R4962:Ap2a2 UTSW 7 141630148 missense probably damaging 1.00
R5602:Ap2a2 UTSW 7 141604942 missense probably benign
R5910:Ap2a2 UTSW 7 141598778 missense probably damaging 1.00
R6488:Ap2a2 UTSW 7 141602307 missense probably benign 0.02
R7003:Ap2a2 UTSW 7 141629196 missense probably benign
R7132:Ap2a2 UTSW 7 141619565 missense probably benign 0.32
R7140:Ap2a2 UTSW 7 141598864 missense probably benign 0.30
R7227:Ap2a2 UTSW 7 141620871 missense probably damaging 1.00
R7412:Ap2a2 UTSW 7 141626136 missense probably damaging 0.97
R7482:Ap2a2 UTSW 7 141602297 missense possibly damaging 0.46
R7632:Ap2a2 UTSW 7 141631323 missense probably benign 0.00
R7991:Ap2a2 UTSW 7 141609847 missense probably damaging 1.00
R8271:Ap2a2 UTSW 7 141620899 missense probably damaging 1.00
R8308:Ap2a2 UTSW 7 141630299 missense probably benign
R8462:Ap2a2 UTSW 7 141630481 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGAGGCTTTCCTGGCTTCC -3'
(R):5'- ATCAGGTCTCAGTGATCTCAGG -3'

Sequencing Primer
(F):5'- AGGCGTCTTGTCATAAGCTC -3'
(R):5'- TGATCTCAGGCAGAGCTCTATAG -3'
Posted On2020-06-30