Incidental Mutation 'R8124:Csnk2a2'
ID631648
Institutional Source Beutler Lab
Gene Symbol Csnk2a2
Ensembl Gene ENSMUSG00000046707
Gene Namecasein kinase 2, alpha prime polypeptide
SynonymsCK2, 1110035J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R8124 (G1)
Quality Score212.009
Status Validated
Chromosome8
Chromosomal Location95446096-95490039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95455947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 296 (P296L)
Ref Sequence ENSEMBL: ENSMUSP00000055919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056919] [ENSMUST00000212214] [ENSMUST00000212952]
Predicted Effect
SMART Domains Protein: ENSMUSP00000055919
Gene: ENSMUSG00000046707
AA Change: P296L

DomainStartEndE-ValueType
S_TKc 40 325 1.85e-77 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212441
Predicted Effect
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000212952
AA Change: P201L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Males homozygotes for a targeted null mutation of the minor catalytic subunit exhibit infertility with oligospermia and abnormally shaped spermatid nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Csnk2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Csnk2a2 APN 8 95477231 missense possibly damaging 0.87
R1452:Csnk2a2 UTSW 8 95457375 splice site probably benign
R1717:Csnk2a2 UTSW 8 95455808 splice site probably null
R4260:Csnk2a2 UTSW 8 95457399 missense probably benign 0.01
R6062:Csnk2a2 UTSW 8 95457469 missense possibly damaging 0.93
R7169:Csnk2a2 UTSW 8 95488378 missense
R8125:Csnk2a2 UTSW 8 95455947 missense
R8126:Csnk2a2 UTSW 8 95455947 missense
R8253:Csnk2a2 UTSW 8 95488377 missense
Predicted Primers PCR Primer
(F):5'- TCTAGTGTTCTGACTGACCTTG -3'
(R):5'- ACAGTGCACCGTTCTAAGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CACCGTTCTAAGGGGTCCTTG -3'
Posted On2020-06-30