Incidental Mutation 'R8124:Ice2'
ID631650
Institutional Source Beutler Lab
Gene Symbol Ice2
Ensembl Gene ENSMUSG00000032235
Gene Nameinteractor of little elongation complex ELL subunit 2
SynonymsNarg2, B230343B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R8124 (G1)
Quality Score221.009
Status Validated
Chromosome9
Chromosomal Location69397906-69433122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69400495 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 20 (N20K)
Ref Sequence ENSEMBL: ENSMUSP00000034761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034761] [ENSMUST00000117246] [ENSMUST00000117610] [ENSMUST00000125938] [ENSMUST00000145538]
Predicted Effect probably damaging
Transcript: ENSMUST00000034761
AA Change: N20K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034761
Gene: ENSMUSG00000032235
AA Change: N20K

DomainStartEndE-ValueType
low complexity region 408 422 N/A INTRINSIC
low complexity region 434 473 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:NARG2_C 726 936 1.7e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117246
AA Change: N20K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000117610
AA Change: N20K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000125938
Predicted Effect probably benign
Transcript: ENSMUST00000145538
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Ice2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ice2 APN 9 69416113 missense probably benign 0.04
IGL01626:Ice2 APN 9 69407332 missense probably benign 0.39
IGL03035:Ice2 APN 9 69425688 missense probably benign 0.06
R0227:Ice2 UTSW 9 69412228 missense probably benign 0.08
R1373:Ice2 UTSW 9 69407119 missense probably benign 0.01
R1381:Ice2 UTSW 9 69400527 missense probably damaging 1.00
R1599:Ice2 UTSW 9 69411442 missense probably null 0.01
R1778:Ice2 UTSW 9 69415648 missense probably benign 0.04
R1818:Ice2 UTSW 9 69432101 missense probably benign 0.00
R1829:Ice2 UTSW 9 69407353 missense probably damaging 0.99
R1876:Ice2 UTSW 9 69415575 missense possibly damaging 0.85
R1878:Ice2 UTSW 9 69428576 critical splice donor site probably null
R2026:Ice2 UTSW 9 69416325 missense probably benign 0.00
R2915:Ice2 UTSW 9 69410840 missense probably benign 0.19
R4097:Ice2 UTSW 9 69421671 missense possibly damaging 0.95
R4815:Ice2 UTSW 9 69407118 missense probably damaging 1.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R5066:Ice2 UTSW 9 69408291 missense probably benign 0.00
R5653:Ice2 UTSW 9 69428380 missense probably benign 0.00
R5898:Ice2 UTSW 9 69408262 missense probably benign 0.08
R5951:Ice2 UTSW 9 69412369 missense possibly damaging 0.67
R6176:Ice2 UTSW 9 69417072 missense probably damaging 1.00
R6566:Ice2 UTSW 9 69416229 missense probably benign
R6632:Ice2 UTSW 9 69428452 missense probably benign 0.07
R7195:Ice2 UTSW 9 69428500 missense possibly damaging 0.91
R7272:Ice2 UTSW 9 69417083 missense possibly damaging 0.46
R7365:Ice2 UTSW 9 69400512 missense probably damaging 1.00
R7495:Ice2 UTSW 9 69416229 missense probably benign 0.01
R7535:Ice2 UTSW 9 69432078 missense probably damaging 0.98
R7937:Ice2 UTSW 9 69410785 missense possibly damaging 0.71
R8381:Ice2 UTSW 9 69410171 missense probably damaging 1.00
R8525:Ice2 UTSW 9 69411416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAGAATTTCACACTGCTC -3'
(R):5'- CAAAGTGTTATCAGCAGCTTTCTTC -3'

Sequencing Primer
(F):5'- TTGAGAATTTCACACTGCTCCAAGC -3'
(R):5'- ACCAAGTGAATATTACCTGTT -3'
Posted On2020-06-30