Incidental Mutation 'R8124:Mip'
ID631652
Institutional Source Beutler Lab
Gene Symbol Mip
Ensembl Gene ENSMUSG00000025389
Gene Namemajor intrinsic protein of lens fiber
SynonymsAqp0, MIP26, aquaporin 0, shrivelled, lens opacity, Cts, Svl, Lop
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128225838-128231812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128226201 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000026455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026455
AA Change: V107A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026455
Gene: ENSMUSG00000025389
AA Change: V107A

DomainStartEndE-ValueType
Pfam:MIP 3 219 5.6e-82 PFAM
Meta Mutation Damage Score 0.4512 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have microphthalmia and lens opacity. Other defects may include degeneration of lens fiber cells, vacuolization of lens fibers and reduced gamma:alpha crystallin ratio. Heterozygotes have less severe forms of lens cataract and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Mip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0963:Mip UTSW 10 128225985 missense probably benign 0.00
R1952:Mip UTSW 10 128225903 missense possibly damaging 0.91
R3110:Mip UTSW 10 128226006 nonsense probably null
R3111:Mip UTSW 10 128226006 nonsense probably null
R3112:Mip UTSW 10 128226006 nonsense probably null
R4646:Mip UTSW 10 128227053 missense probably benign 0.00
R4648:Mip UTSW 10 128227053 missense probably benign 0.00
R5650:Mip UTSW 10 128226065 missense possibly damaging 0.74
R6227:Mip UTSW 10 128226006 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGCTACATTGGTGCAGAC -3'
(R):5'- AGGGGACTTGAACTCAACTTTCTG -3'

Sequencing Primer
(F):5'- CAGACTGTGGGTCACATCAGTG -3'
(R):5'- AACTTTCTGGATTCACCACGGAGG -3'
Posted On2020-06-30