Incidental Mutation 'R8124:Evl'
ID631656
Institutional Source Beutler Lab
Gene Symbol Evl
Ensembl Gene ENSMUSG00000021262
Gene NameEna-vasodilator stimulated phosphoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108554720-108688516 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108681524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 295 (R295*)
Ref Sequence ENSEMBL: ENSMUSP00000152364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000172409] [ENSMUST00000223109]
Predicted Effect probably null
Transcript: ENSMUST00000021689
AA Change: R308*
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077735
AA Change: R308*
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109854
AA Change: R314*
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262
AA Change: R314*

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172409
AA Change: R295*
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262
AA Change: R295*

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222255
Predicted Effect probably null
Transcript: ENSMUST00000223109
AA Change: R295*
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Meta Mutation Damage Score 0.9757 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable with no apparent defects in gross morphology or histology. Mice homozygous for a different knock-out allele are viable and fertile but display defects in monocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Evl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Evl APN 12 108648419 missense possibly damaging 0.47
IGL03391:Evl APN 12 108676099 splice site probably null
Husk UTSW 12 108648460 missense probably damaging 1.00
Pencil UTSW 12 108681524 nonsense probably null
Shaving UTSW 12 108648308 splice site probably benign
R0366:Evl UTSW 12 108686048 critical splice acceptor site probably null
R0603:Evl UTSW 12 108648422 missense probably damaging 1.00
R1843:Evl UTSW 12 108652996 missense probably damaging 1.00
R3431:Evl UTSW 12 108648308 splice site probably benign
R3432:Evl UTSW 12 108648308 splice site probably benign
R4915:Evl UTSW 12 108686106 missense probably damaging 1.00
R5137:Evl UTSW 12 108681522 missense probably benign 0.00
R5688:Evl UTSW 12 108673353 critical splice donor site probably null
R5933:Evl UTSW 12 108683257 missense possibly damaging 0.60
R5950:Evl UTSW 12 108675553 missense probably benign 0.16
R6144:Evl UTSW 12 108653031 missense probably damaging 1.00
R7235:Evl UTSW 12 108648460 missense probably damaging 1.00
R7369:Evl UTSW 12 108686565 missense unknown
R7639:Evl UTSW 12 108686103 missense probably damaging 1.00
R7822:Evl UTSW 12 108648464 missense probably damaging 1.00
R7967:Evl UTSW 12 108681524 nonsense probably null
R7968:Evl UTSW 12 108681524 nonsense probably null
R7970:Evl UTSW 12 108681524 nonsense probably null
R7972:Evl UTSW 12 108681524 nonsense probably null
R7973:Evl UTSW 12 108681524 nonsense probably null
R8017:Evl UTSW 12 108681524 nonsense probably null
R8019:Evl UTSW 12 108681524 nonsense probably null
R8020:Evl UTSW 12 108681524 nonsense probably null
R8046:Evl UTSW 12 108681524 nonsense probably null
R8105:Evl UTSW 12 108681524 nonsense probably null
R8122:Evl UTSW 12 108681524 nonsense probably null
R8123:Evl UTSW 12 108681524 nonsense probably null
R8125:Evl UTSW 12 108681524 nonsense probably null
R8126:Evl UTSW 12 108681524 nonsense probably null
R8298:Evl UTSW 12 108652973 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGCCTAGTGATGTAAGGATTGTGC -3'
(R):5'- CCTTAGCTGGACCAGATCAAGG -3'

Sequencing Primer
(F):5'- TGCTCTTGACTGAGAGACATAGACTG -3'
(R):5'- ACACCTGCCTAGCTGTCTG -3'
Posted On2020-06-30