Incidental Mutation 'R8124:Papd7'
ID631658
Institutional Source Beutler Lab
Gene Symbol Papd7
Ensembl Gene ENSMUSG00000034575
Gene NamePAP associated domain containing 7
SynonymsPols, LAK-1, TRF4, TRF4-1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198600.2, NM_001169131.1; MGI: 2682295

Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R8124 (G1)
Quality Score101.008
Status Not validated
Chromosome13
Chromosomal Location69497959-69534617 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 69533597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044081] [ENSMUST00000143716] [ENSMUST00000198607] [ENSMUST00000223344]
Predicted Effect probably benign
Transcript: ENSMUST00000044081
SMART Domains Protein: ENSMUSP00000040757
Gene: ENSMUSG00000034575

DomainStartEndE-ValueType
Pfam:NTP_transf_2 15 124 4.1e-20 PFAM
Pfam:PAP_assoc 178 238 5.4e-19 PFAM
low complexity region 343 368 N/A INTRINSIC
low complexity region 496 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143716
Predicted Effect silent
Transcript: ENSMUST00000198607
SMART Domains Protein: ENSMUSP00000142516
Gene: ENSMUSG00000034575

DomainStartEndE-ValueType
low complexity region 46 98 N/A INTRINSIC
low complexity region 106 118 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
Pfam:NTP_transf_2 258 368 1.6e-14 PFAM
Pfam:PAP_assoc 421 481 8.3e-16 PFAM
low complexity region 586 611 N/A INTRINSIC
low complexity region 739 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223344
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Papd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Papd7 APN 13 69500559 missense probably benign 0.02
IGL02690:Papd7 APN 13 69510625 missense probably benign 0.01
IGL03047:Papd7 UTSW 13 69502911 missense probably damaging 1.00
P0027:Papd7 UTSW 13 69506955 nonsense probably null
R0309:Papd7 UTSW 13 69499932 missense possibly damaging 0.95
R1713:Papd7 UTSW 13 69503051 missense probably benign 0.10
R2936:Papd7 UTSW 13 69502327 missense possibly damaging 0.82
R3809:Papd7 UTSW 13 69512996 missense probably damaging 0.98
R4927:Papd7 UTSW 13 69502900 splice site probably null
R6419:Papd7 UTSW 13 69510666 missense possibly damaging 0.91
R7011:Papd7 UTSW 13 69500080 missense probably damaging 1.00
R7505:Papd7 UTSW 13 69506928 missense probably damaging 1.00
R7547:Papd7 UTSW 13 69533704 missense probably benign 0.04
R7554:Papd7 UTSW 13 69500072 missense probably damaging 1.00
R8040:Papd7 UTSW 13 69500481 missense probably damaging 0.99
RF027:Papd7 UTSW 13 69533854 unclassified probably benign
RF039:Papd7 UTSW 13 69533854 unclassified probably benign
T0722:Papd7 UTSW 13 69506955 nonsense probably null
Z1177:Papd7 UTSW 13 69503634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTTTCTAGTCTAGCCCTAGG -3'
(R):5'- CAAGACGCTTGCACAAGTCC -3'

Sequencing Primer
(F):5'- CTGCCTGGTGGATCTCGATC -3'
(R):5'- TTGCACAAGTCCCCGTCG -3'
Posted On2020-06-30