Incidental Mutation 'R0707:Herc6'
ID63166
Institutional Source Beutler Lab
Gene Symbol Herc6
Ensembl Gene ENSMUSG00000029798
Gene Namehect domain and RLD 6
SynonymsHerc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0707 (G1)
Quality Score219
Status Validated
Chromosome6
Chromosomal Location57581000-57664632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57662362 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 905 (G905E)
Ref Sequence ENSEMBL: ENSMUSP00000031817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031817
AA Change: G905E

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: G905E

DomainStartEndE-ValueType
Pfam:RCC1 40 89 1.9e-12 PFAM
Pfam:RCC1 92 142 4.8e-17 PFAM
Pfam:RCC1_2 129 158 3.4e-14 PFAM
Pfam:RCC1 145 195 1.6e-18 PFAM
Pfam:RCC1_2 183 211 1e-8 PFAM
Pfam:RCC1 198 250 2e-10 PFAM
Pfam:RCC1_2 237 266 4e-10 PFAM
Pfam:RCC1 253 301 4.8e-9 PFAM
low complexity region 359 373 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
HECTc 677 1003 1.03e-57 SMART
Meta Mutation Damage Score 0.3585 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Herc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Herc6 APN 6 57607145 missense probably benign 0.03
IGL00836:Herc6 APN 6 57619549 missense probably damaging 0.98
IGL01289:Herc6 APN 6 57598623 missense probably damaging 1.00
IGL01631:Herc6 APN 6 57604107 missense probably benign 0.03
IGL02656:Herc6 APN 6 57611836 critical splice donor site probably null
IGL02966:Herc6 APN 6 57583333 critical splice donor site probably null
IGL03297:Herc6 APN 6 57662389 missense probably benign 0.03
IGL02835:Herc6 UTSW 6 57646161 missense possibly damaging 0.94
R0218:Herc6 UTSW 6 57619601 missense probably benign 0.00
R0470:Herc6 UTSW 6 57619452 missense probably damaging 1.00
R0699:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0702:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0850:Herc6 UTSW 6 57583242 missense possibly damaging 0.84
R1067:Herc6 UTSW 6 57662219 missense probably damaging 1.00
R1740:Herc6 UTSW 6 57652065 missense probably benign
R1840:Herc6 UTSW 6 57658106 nonsense probably null
R1889:Herc6 UTSW 6 57662075 nonsense probably null
R1938:Herc6 UTSW 6 57625941 missense probably damaging 1.00
R2024:Herc6 UTSW 6 57583332 missense probably benign 0.04
R2051:Herc6 UTSW 6 57625976 missense probably benign 0.00
R2238:Herc6 UTSW 6 57654401 missense probably benign 0.05
R2244:Herc6 UTSW 6 57598617 nonsense probably null
R4085:Herc6 UTSW 6 57647069 missense probably benign 0.09
R4410:Herc6 UTSW 6 57659679 missense possibly damaging 0.82
R4490:Herc6 UTSW 6 57654495 missense probably damaging 1.00
R4599:Herc6 UTSW 6 57659713 missense probably benign 0.34
R4716:Herc6 UTSW 6 57598438 missense probably damaging 1.00
R4757:Herc6 UTSW 6 57600060 critical splice donor site probably null
R4761:Herc6 UTSW 6 57662900 missense probably benign 0.01
R4798:Herc6 UTSW 6 57604166 missense probably damaging 1.00
R4826:Herc6 UTSW 6 57647087 missense probably benign 0.00
R5520:Herc6 UTSW 6 57647120 missense possibly damaging 0.51
R5545:Herc6 UTSW 6 57658007 critical splice acceptor site probably null
R5664:Herc6 UTSW 6 57618684 missense probably benign
R5763:Herc6 UTSW 6 57662887 missense probably damaging 1.00
R5916:Herc6 UTSW 6 57646203 missense probably benign
R6115:Herc6 UTSW 6 57583206 missense probably benign 0.01
R6225:Herc6 UTSW 6 57662154 missense possibly damaging 0.50
R7287:Herc6 UTSW 6 57651980 intron probably null
R7319:Herc6 UTSW 6 57604089 missense probably damaging 1.00
R7375:Herc6 UTSW 6 57651806 intron probably null
R7480:Herc6 UTSW 6 57581221 missense possibly damaging 0.66
R7485:Herc6 UTSW 6 57581104 missense probably benign 0.00
R7670:Herc6 UTSW 6 57660122 missense probably damaging 1.00
Z1176:Herc6 UTSW 6 57600031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATTCCAGCCCGAAGAACTAATG -3'
(R):5'- TGCAGCCTATCACATCCTGTAAGAAAC -3'

Sequencing Primer
(F):5'- GACAGCAATAATTGGAAATGCTAC -3'
(R):5'- CCTAGAAAAATCATGACTTTGGGGG -3'
Posted On2013-07-30