Incidental Mutation 'R8124:Skiv2l2'
ID631660
Institutional Source Beutler Lab
Gene Symbol Skiv2l2
Ensembl Gene ENSMUSG00000016018
Gene Namesuperkiller viralicidic activity 2-like 2 (S. cerevisiae)
Synonyms2610528A15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028151.2; MGI:1919448

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location112867418-112927398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112927337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 7 (D7E)
Ref Sequence ENSEMBL: ENSMUSP00000022281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022281] [ENSMUST00000038574] [ENSMUST00000224176]
Predicted Effect probably benign
Transcript: ENSMUST00000022281
AA Change: D7E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018
AA Change: D7E

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DEXDc 134 317 6.42e-34 SMART
HELICc 437 526 3.14e-19 SMART
Pfam:rRNA_proc-arch 580 839 1.7e-91 PFAM
DSHCT 863 1040 1.69e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038574
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224176
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Skiv2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Skiv2l2 APN 13 112914489 missense probably damaging 1.00
IGL01772:Skiv2l2 APN 13 112891325 missense probably benign 0.10
IGL01843:Skiv2l2 APN 13 112918561 splice site probably benign
IGL01972:Skiv2l2 APN 13 112881061 missense probably damaging 1.00
IGL02451:Skiv2l2 APN 13 112891347 missense probably damaging 1.00
IGL02716:Skiv2l2 APN 13 112883146 missense probably benign 0.13
IGL03234:Skiv2l2 APN 13 112880975 splice site probably benign
K3955:Skiv2l2 UTSW 13 112910979 nonsense probably null
P0038:Skiv2l2 UTSW 13 112910979 nonsense probably null
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0086:Skiv2l2 UTSW 13 112927328 missense probably benign 0.00
R0687:Skiv2l2 UTSW 13 112914361 missense probably damaging 1.00
R1216:Skiv2l2 UTSW 13 112914342 splice site probably benign
R1218:Skiv2l2 UTSW 13 112917622 missense probably damaging 1.00
R1312:Skiv2l2 UTSW 13 112883251 nonsense probably null
R1827:Skiv2l2 UTSW 13 112913099 critical splice donor site probably null
R1852:Skiv2l2 UTSW 13 112872927 missense probably benign 0.00
R1889:Skiv2l2 UTSW 13 112887490 missense probably benign 0.00
R2205:Skiv2l2 UTSW 13 112898890 missense probably benign 0.06
R2256:Skiv2l2 UTSW 13 112876512 missense probably damaging 0.98
R2394:Skiv2l2 UTSW 13 112883168 missense probably benign 0.02
R3717:Skiv2l2 UTSW 13 112895595 missense probably damaging 1.00
R3779:Skiv2l2 UTSW 13 112903392 splice site probably benign
R4613:Skiv2l2 UTSW 13 112921739 nonsense probably null
R4939:Skiv2l2 UTSW 13 112909892 missense possibly damaging 0.91
R5452:Skiv2l2 UTSW 13 112913181 missense probably null 0.96
R5591:Skiv2l2 UTSW 13 112927356 start codon destroyed probably null 0.88
R5688:Skiv2l2 UTSW 13 112873056 nonsense probably null
R5761:Skiv2l2 UTSW 13 112917662 missense probably damaging 0.96
R5789:Skiv2l2 UTSW 13 112891285 missense probably benign 0.01
R5851:Skiv2l2 UTSW 13 112908952 missense probably damaging 1.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6348:Skiv2l2 UTSW 13 112910917 missense possibly damaging 0.88
R7276:Skiv2l2 UTSW 13 112914439 missense probably benign 0.00
R7397:Skiv2l2 UTSW 13 112921686 missense probably benign
R7792:Skiv2l2 UTSW 13 112872909 missense probably benign 0.02
R7863:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7948:Skiv2l2 UTSW 13 112921762 missense probably benign 0.02
R8035:Skiv2l2 UTSW 13 112898802 missense probably benign 0.09
R8152:Skiv2l2 UTSW 13 112872983 nonsense probably null
R8189:Skiv2l2 UTSW 13 112891981 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGTCGTGTTTCCTTTACCGG -3'
(R):5'- TCATTGAACTGCCGGACTCG -3'

Sequencing Primer
(F):5'- GTGTTTCCTTTACCGGCATCAAAAAC -3'
(R):5'- ACTCGCAGTGGTTGGAAG -3'
Posted On2020-06-30