Incidental Mutation 'R8124:Slc4a7'
ID631661
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R8124 (G1)
Quality Score214.009
Status Validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14729211 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 20 (E20K)
Ref Sequence ENSEMBL: ENSMUSP00000058313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225175] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225630] [ENSMUST00000225979] [ENSMUST00000226079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057015
AA Change: E20K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: E20K

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223607
AA Change: E20K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223695
AA Change: E26K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223740
AA Change: E26K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223761
AA Change: E20K

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000223981
AA Change: E20K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224049
AA Change: E26K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000224222
AA Change: E20K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224333
AA Change: E26K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224672
AA Change: E26K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224752
AA Change: E25K

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000225175
AA Change: E20K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225232
AA Change: E20K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225238
AA Change: E20K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225630
AA Change: E20K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225979
AA Change: E20K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226079
AA Change: E20K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1128:Slc4a7 UTSW 14 14733832 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4368:Slc4a7 UTSW 14 14733775 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4592:Slc4a7 UTSW 14 14778850 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6065:Slc4a7 UTSW 14 14739836 missense probably benign 0.29
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7378:Slc4a7 UTSW 14 14757421 missense probably damaging 1.00
R7646:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7647:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7648:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7650:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7857:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7892:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R8225:Slc4a7 UTSW 14 14738224 nonsense probably null
R8354:Slc4a7 UTSW 14 14786313 missense probably damaging 1.00
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGGTTTATGACACTGTCACTTTC -3'
(R):5'- GTCTGCAGAACTATTATTCATTGCAC -3'

Sequencing Primer
(F):5'- ACTGTCACTTTCATTCTTACTATGAG -3'
(R):5'- CTTCTAAGTAACAACATTTCCAGACG -3'
Posted On2020-06-30