Incidental Mutation 'R8124:Lgi3'
ID631665
Institutional Source Beutler Lab
Gene Symbol Lgi3
Ensembl Gene ENSMUSG00000033595
Gene Nameleucine-rich repeat LGI family, member 3
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_145219.4; MGI: 2182619

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70530685-70538324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70534738 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 241 (Y241C)
Ref Sequence ENSEMBL: ENSMUSP00000046705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047331] [ENSMUST00000226548]
Predicted Effect probably damaging
Transcript: ENSMUST00000047331
AA Change: Y241C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046705
Gene: ENSMUSG00000033595
AA Change: Y241C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 47 N/A INTRINSIC
LRR 87 110 2.63e0 SMART
LRR 111 134 1.07e0 SMART
LRR_TYP 135 158 2.84e-5 SMART
LRRCT 170 219 2.76e-4 SMART
Pfam:EPTP 222 263 7.6e-13 PFAM
Pfam:EPTP 268 309 1.3e-12 PFAM
Pfam:EPTP 314 360 1.1e-14 PFAM
Pfam:EPTP 363 405 2.4e-9 PFAM
Pfam:EPTP 410 452 1.2e-11 PFAM
Pfam:EPTP 455 496 2.2e-12 PFAM
Pfam:EPTP 501 541 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226548
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Lgi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Lgi3 APN 14 70533385 missense probably benign 0.05
IGL02203:Lgi3 APN 14 70534518 missense possibly damaging 0.68
P0007:Lgi3 UTSW 14 70536712 missense probably damaging 1.00
R0114:Lgi3 UTSW 14 70531029 start gained probably benign
R0225:Lgi3 UTSW 14 70532821 missense probably benign
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0244:Lgi3 UTSW 14 70534698 missense probably benign 0.30
R0396:Lgi3 UTSW 14 70534840 missense probably damaging 1.00
R0479:Lgi3 UTSW 14 70534552 unclassified probably benign
R1652:Lgi3 UTSW 14 70531216 missense probably damaging 0.99
R1840:Lgi3 UTSW 14 70534776 splice site probably null
R1930:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R1931:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R2474:Lgi3 UTSW 14 70533249 critical splice donor site probably null
R4672:Lgi3 UTSW 14 70534457 missense possibly damaging 0.62
R5979:Lgi3 UTSW 14 70536460 missense probably damaging 1.00
R6385:Lgi3 UTSW 14 70531170 missense possibly damaging 0.66
R7146:Lgi3 UTSW 14 70533392 missense probably damaging 1.00
R7314:Lgi3 UTSW 14 70532112 missense probably damaging 1.00
R7712:Lgi3 UTSW 14 70531111 missense unknown
R8417:Lgi3 UTSW 14 70534806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTGCATCACCACTGGTAG -3'
(R):5'- ACTGGAGTTAGACAAAAGAGCCTC -3'

Sequencing Primer
(F):5'- ATCACCACTGGTAGGATGTGC -3'
(R):5'- GGAGTTAGACAAAAGAGCCTCCTATC -3'
Posted On2020-06-30