Mutagenetix > Incidental Mutations

Incidental Mutation 'R8124:St6gal1'

631671

Institutional Source

Beutler Lab

Gene Symbol

St6gal1

Ensembl Gene

ENSMUSG00000022885

Gene Name

beta galactoside alpha 2,6 sialyltransferase 1

Synonyms

St6Gal-I, Siat1, ST6Gal I

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R8124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23224740-23360350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 23357835 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 393 (A393T)

Ref Sequence

ENSEMBL: ENSMUSP00000023601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023601] [ENSMUST00000115335] [ENSMUST00000178797]

Predicted Effect

probably benign
Transcript: ENSMUST00000023601
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000023601
Gene: ENSMUSG00000022885
AA Change: A393T

Domain	Start	End	E-Value	Type
transmembrane domain	9	26	N/A	INTRINSIC
Pfam:Glyco_transf_29	127	389	2.3e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115335
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110992
Gene: ENSMUSG00000022885
AA Change: A393T

Domain	Start	End	E-Value	Type
transmembrane domain	9	26	N/A	INTRINSIC
Pfam:Glyco_transf_29	140	383	8.3e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178797
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000136206
Gene: ENSMUSG00000022885
AA Change: A393T

Domain	Start	End	E-Value	Type
transmembrane domain	9	26	N/A	INTRINSIC
Pfam:Glyco_transf_29	127	389	2.3e-63	PFAM

Meta Mutation Damage Score

0.0812

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap3	T	A	5: 24,478,130	I320N	probably benign	Het
Ahnak	G	A	19: 9,007,123	G1924S	probably damaging	Het
Ap2a2	G	A	7: 141,598,844	R141H	probably benign	Het
Atf7ip2	T	C	16: 10,209,135	V89A	possibly damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Csnk2a2	G	A	8: 95,455,947	P296L		Het
Dab2	T	A	15: 6,429,397	C263*	probably null	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Ddx60	C	T	8: 61,983,911	A965V	probably benign	Het
Dennd5a	A	T	7: 109,897,935	I1119N	probably damaging	Het
Dpy30	A	G	17: 74,316,104		probably benign	Het
Epg5	G	A	18: 77,964,996	A780T	probably benign	Het
Etl4	A	G	2: 20,806,640	D1546G	probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
F13a1	T	C	13: 37,025,805	K62R	probably damaging	Het
Gm2832	T	C	14: 41,278,937	M44T		Het
Gm884	A	G	11: 103,620,431	V237A	unknown	Het
Gm9195	T	C	14: 72,442,623	I2249V	probably benign	Het
Hmcn2	T	C	2: 31,400,124	V2323A	probably benign	Het
Ice2	T	A	9: 69,400,495	N20K	probably damaging	Het
Klf15	T	C	6: 90,466,881	F146S	probably damaging	Het
Lgi3	A	G	14: 70,534,738	Y241C	probably damaging	Het
Lig4	A	T	8: 9,972,954	D275E	probably damaging	Het
Lrit1	T	A	14: 37,062,048	S444R	probably benign	Het
Mip	T	C	10: 128,226,201	V107A	possibly damaging	Het
Myo15	G	A	11: 60,507,453	V1581M		Het
Nckap1l	A	G	15: 103,473,821	D481G	possibly damaging	Het
Obox3	A	T	7: 15,589,949		probably null	Het
Olfr1438-ps1	T	A	19: 12,333,470	N129Y	probably damaging	Het
Olfr491	C	A	7: 108,317,777	N294K	possibly damaging	Het
Olfr707	G	A	7: 106,891,881	T76I	possibly damaging	Het
Olfr749	C	T	14: 50,736,286	R292H	probably benign	Het
Olfr944	T	C	9: 39,217,671	F105L	probably benign	Het
Papd7	G	A	13: 69,533,597		probably benign	Het
Pilrb2	T	A	5: 137,871,044	E98V	probably damaging	Het
Plekhm1	A	G	11: 103,366,949	V1053A	probably benign	Het
Prdm2	A	T	4: 143,135,265	V485E	probably damaging	Het
Riox2	G	A	16: 59,486,591	E282K	probably benign	Het
Rps6ka2	T	A	17: 7,281,829	V379E	possibly damaging	Het
Skiv2l2	A	C	13: 112,927,337	D7E	probably benign	Het
Slc4a7	G	A	14: 14,729,211	E20K	possibly damaging	Het
Sned1	G	A	1: 93,282,989		probably null	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
Tmem132d	T	C	5: 127,792,560	Q570R	probably damaging	Het
Tmem87a	T	C	2: 120,392,195	T168A	probably benign	Het
Trank1	A	G	9: 111,378,927	R1747G	probably benign	Het
Txk	C	T	5: 72,703,263		probably null	Het
Vcan	T	A	13: 89,704,254	L862F	possibly damaging	Het
Wdr64	A	T	1: 175,799,278		probably null	Het
Zfp106	G	T	2: 120,524,331	Q1343K	probably benign	Het
Zfp719	A	G	7: 43,589,890	T301A	probably benign	Het

Other mutations in St6gal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:St6gal1	APN	16	23356392	splice site	probably benign
IGL01667:St6gal1	APN	16	23321424	missense	probably benign	0.00
IGL01783:St6gal1	APN	16	23321555	missense	probably benign	0.29
IGL02996:St6gal1	APN	16	23321154	missense	probably damaging	0.98
R0049:St6gal1	UTSW	16	23321141	missense	probably damaging	1.00
R0049:St6gal1	UTSW	16	23321141	missense	probably damaging	1.00
R0295:St6gal1	UTSW	16	23356203	splice site	probably benign
R1290:St6gal1	UTSW	16	23321661	missense	probably benign	0.03
R1352:St6gal1	UTSW	16	23321651	missense	probably damaging	1.00
R1817:St6gal1	UTSW	16	23321333	nonsense	probably null
R1911:St6gal1	UTSW	16	23321633	missense	probably damaging	0.99
R2113:St6gal1	UTSW	16	23328417	missense	probably damaging	0.98
R4591:St6gal1	UTSW	16	23321294	missense	probably benign	0.00
R5761:St6gal1	UTSW	16	23321055	utr 5 prime	probably benign
R6554:St6gal1	UTSW	16	23321655	missense	probably benign	0.00
R6925:St6gal1	UTSW	16	23356213	missense	probably damaging	1.00
R7658:St6gal1	UTSW	16	23356228	missense	probably damaging	1.00
R7740:St6gal1	UTSW	16	23321035	splice site	probably benign
R7967:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R7970:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R7973:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8017:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8017:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8018:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8019:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8044:St6gal1	UTSW	16	23357835	missense	probably benign	0.01
R8122:St6gal1	UTSW	16	23354894	missense	probably benign	0.00
R8123:St6gal1	UTSW	16	23357835	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAAGTTGATATTTACGAGTTCCTCCC -3'
(R):5'- TACGGCAAGAATCTGGGCTC -3'

Sequencing Primer
(F):5'- GAGTTCCTCCCATCCAAGCG -3'
(R):5'- TTGCCATCAGACACTGGAG -3'

Posted On

2020-06-30