Incidental Mutation 'R8124:St6gal1'
ID631671
Institutional Source Beutler Lab
Gene Symbol St6gal1
Ensembl Gene ENSMUSG00000022885
Gene Namebeta galactoside alpha 2,6 sialyltransferase 1
SynonymsSt6Gal-I, Siat1, ST6Gal I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23224740-23360350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23357835 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 393 (A393T)
Ref Sequence ENSEMBL: ENSMUSP00000023601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023601] [ENSMUST00000115335] [ENSMUST00000178797]
Predicted Effect probably benign
Transcript: ENSMUST00000023601
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023601
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115335
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110992
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 140 383 8.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178797
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136206
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in St6gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:St6gal1 APN 16 23356392 splice site probably benign
IGL01667:St6gal1 APN 16 23321424 missense probably benign 0.00
IGL01783:St6gal1 APN 16 23321555 missense probably benign 0.29
IGL02996:St6gal1 APN 16 23321154 missense probably damaging 0.98
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0295:St6gal1 UTSW 16 23356203 splice site probably benign
R1290:St6gal1 UTSW 16 23321661 missense probably benign 0.03
R1352:St6gal1 UTSW 16 23321651 missense probably damaging 1.00
R1817:St6gal1 UTSW 16 23321333 nonsense probably null
R1911:St6gal1 UTSW 16 23321633 missense probably damaging 0.99
R2113:St6gal1 UTSW 16 23328417 missense probably damaging 0.98
R4591:St6gal1 UTSW 16 23321294 missense probably benign 0.00
R5761:St6gal1 UTSW 16 23321055 utr 5 prime probably benign
R6554:St6gal1 UTSW 16 23321655 missense probably benign 0.00
R6925:St6gal1 UTSW 16 23356213 missense probably damaging 1.00
R7658:St6gal1 UTSW 16 23356228 missense probably damaging 1.00
R7740:St6gal1 UTSW 16 23321035 splice site probably benign
R7967:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R7970:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R7973:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8017:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8017:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8018:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8019:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8044:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8122:St6gal1 UTSW 16 23354894 missense probably benign 0.00
R8123:St6gal1 UTSW 16 23357835 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTTGATATTTACGAGTTCCTCCC -3'
(R):5'- TACGGCAAGAATCTGGGCTC -3'

Sequencing Primer
(F):5'- GAGTTCCTCCCATCCAAGCG -3'
(R):5'- TTGCCATCAGACACTGGAG -3'
Posted On2020-06-30