Incidental Mutation 'R8124:Riox2'
ID631672
Institutional Source Beutler Lab
Gene Symbol Riox2
Ensembl Gene ENSMUSG00000022724
Gene Nameribosomal oxygenase 2
Synonyms3830408E23Rik, 1810047J07Rik, Mina, 2410057H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R8124 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59471775-59492461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59486591 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 282 (E282K)
Ref Sequence ENSEMBL: ENSMUSP00000023407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023407] [ENSMUST00000044604] [ENSMUST00000120674] [ENSMUST00000160571]
Predicted Effect probably benign
Transcript: ENSMUST00000023407
AA Change: E282K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023407
Gene: ENSMUSG00000022724
AA Change: E282K

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120674
AA Change: E282K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112899
Gene: ENSMUSG00000022724
AA Change: E282K

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160571
AA Change: E282K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125297
Gene: ENSMUSG00000022724
AA Change: E282K

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]; Zhang et al., 2005 [PubMed 15897898]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced allergic response to house dust mites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Obox3 A T 7: 15,589,949 probably null Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Riox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Riox2 APN 16 59489417 missense probably benign 0.03
IGL02580:Riox2 APN 16 59486573 missense probably benign 0.00
IGL03076:Riox2 APN 16 59491212 missense possibly damaging 0.68
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0322:Riox2 UTSW 16 59489389 nonsense probably null
R0592:Riox2 UTSW 16 59489579 unclassified probably benign
R0620:Riox2 UTSW 16 59491892 missense probably benign 0.20
R1588:Riox2 UTSW 16 59475583 missense possibly damaging 0.46
R1623:Riox2 UTSW 16 59483042 missense probably damaging 1.00
R2863:Riox2 UTSW 16 59489393 missense probably damaging 0.99
R4113:Riox2 UTSW 16 59491894 missense probably benign 0.01
R4468:Riox2 UTSW 16 59475994 intron probably benign
R4708:Riox2 UTSW 16 59475682 missense probably benign 0.00
R4739:Riox2 UTSW 16 59489369 missense probably benign
R5074:Riox2 UTSW 16 59491873 missense possibly damaging 0.59
R5385:Riox2 UTSW 16 59486616 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGCTCAGAAATGGGAAATGTG -3'
(R):5'- AGATGGCCCACATGAATGG -3'

Sequencing Primer
(F):5'- GGAAATGTGAACCCAGTTTGC -3'
(R):5'- TGAATGGCCCTACATGAAGC -3'
Posted On2020-06-30