Mutagenetix > Incidental Mutations

Incidental Mutation 'R8124:Epg5'

631676

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R8124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77964996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 780 (A780T)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably benign
Transcript: ENSMUST00000044622
AA Change: A780T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: A780T

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap3	T	A	5: 24,478,130	I320N	probably benign	Het
Ahnak	G	A	19: 9,007,123	G1924S	probably damaging	Het
Ap2a2	G	A	7: 141,598,844	R141H	probably benign	Het
Atf7ip2	T	C	16: 10,209,135	V89A	possibly damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Csnk2a2	G	A	8: 95,455,947	P296L		Het
Dab2	T	A	15: 6,429,397	C263*	probably null	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Ddx60	C	T	8: 61,983,911	A965V	probably benign	Het
Dennd5a	A	T	7: 109,897,935	I1119N	probably damaging	Het
Dpy30	A	G	17: 74,316,104		probably benign	Het
Etl4	A	G	2: 20,806,640	D1546G	probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
F13a1	T	C	13: 37,025,805	K62R	probably damaging	Het
Gm2832	T	C	14: 41,278,937	M44T		Het
Gm884	A	G	11: 103,620,431	V237A	unknown	Het
Gm9195	T	C	14: 72,442,623	I2249V	probably benign	Het
Hmcn2	T	C	2: 31,400,124	V2323A	probably benign	Het
Ice2	T	A	9: 69,400,495	N20K	probably damaging	Het
Klf15	T	C	6: 90,466,881	F146S	probably damaging	Het
Lgi3	A	G	14: 70,534,738	Y241C	probably damaging	Het
Lig4	A	T	8: 9,972,954	D275E	probably damaging	Het
Lrit1	T	A	14: 37,062,048	S444R	probably benign	Het
Mip	T	C	10: 128,226,201	V107A	possibly damaging	Het
Myo15	G	A	11: 60,507,453	V1581M		Het
Nckap1l	A	G	15: 103,473,821	D481G	possibly damaging	Het
Obox3	A	T	7: 15,589,949		probably null	Het
Olfr1438-ps1	T	A	19: 12,333,470	N129Y	probably damaging	Het
Olfr491	C	A	7: 108,317,777	N294K	possibly damaging	Het
Olfr707	G	A	7: 106,891,881	T76I	possibly damaging	Het
Olfr749	C	T	14: 50,736,286	R292H	probably benign	Het
Olfr944	T	C	9: 39,217,671	F105L	probably benign	Het
Papd7	G	A	13: 69,533,597		probably benign	Het
Pilrb2	T	A	5: 137,871,044	E98V	probably damaging	Het
Plekhm1	A	G	11: 103,366,949	V1053A	probably benign	Het
Prdm2	A	T	4: 143,135,265	V485E	probably damaging	Het
Riox2	G	A	16: 59,486,591	E282K	probably benign	Het
Rps6ka2	T	A	17: 7,281,829	V379E	possibly damaging	Het
Skiv2l2	A	C	13: 112,927,337	D7E	probably benign	Het
Slc4a7	G	A	14: 14,729,211	E20K	possibly damaging	Het
Sned1	G	A	1: 93,282,989		probably null	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tmem132d	T	C	5: 127,792,560	Q570R	probably damaging	Het
Tmem87a	T	C	2: 120,392,195	T168A	probably benign	Het
Trank1	A	G	9: 111,378,927	R1747G	probably benign	Het
Txk	C	T	5: 72,703,263		probably null	Het
Vcan	T	A	13: 89,704,254	L862F	possibly damaging	Het
Wdr64	A	T	1: 175,799,278		probably null	Het
Zfp106	G	T	2: 120,524,331	Q1343K	probably benign	Het
Zfp719	A	G	7: 43,589,890	T301A	probably benign	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGAACTGGTAGGGATCCA -3'
(R):5'- TCACCTCACAGATCTCACACTCT -3'

Sequencing Primer
(F):5'- TCCATTTTGGAAAGGGGAAGATTC -3'
(R):5'- GATCTCACACTCTCACCTCACAGATC -3'

Posted On

2020-06-30